Incidental Mutation 'R3552:Spns1'
ID268996
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Namespinster homolog 1
Synonyms2210013K02Rik
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3552 (G1)
Quality Score212
Status Validated
Chromosome7
Chromosomal Location126370060-126377450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126370371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 512 (V512A)
Ref Sequence ENSEMBL: ENSMUSP00000032994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000032997] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000138141] [ENSMUST00000150476] [ENSMUST00000205366] [ENSMUST00000205642] [ENSMUST00000205930] [ENSMUST00000206793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032994
AA Change: V512A

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741
AA Change: V512A

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032997
SMART Domains Protein: ENSMUSP00000032997
Gene: ENSMUSG00000030742

DomainStartEndE-ValueType
Pfam:LAT 1 242 4.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119754
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119846
AA Change: V460A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741
AA Change: V460A

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect probably benign
Transcript: ENSMUST00000138141
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150476
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184637
Predicted Effect probably benign
Transcript: ENSMUST00000205366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205398
Predicted Effect probably benign
Transcript: ENSMUST00000205642
Predicted Effect probably benign
Transcript: ENSMUST00000205930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206731
Predicted Effect probably benign
Transcript: ENSMUST00000206793
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 126371242 unclassified probably null
IGL02353:Spns1 APN 7 126375140 missense probably damaging 1.00
IGL02561:Spns1 APN 7 126373769 critical splice donor site probably null
IGL03403:Spns1 APN 7 126371536 splice site probably null
R1634:Spns1 UTSW 7 126371171 unclassified probably benign
R2327:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R3916:Spns1 UTSW 7 126371539 critical splice donor site probably null
R4025:Spns1 UTSW 7 126376946 nonsense probably null
R4095:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R4656:Spns1 UTSW 7 126374302 unclassified probably benign
R4657:Spns1 UTSW 7 126374302 unclassified probably benign
R4697:Spns1 UTSW 7 126377037 missense probably damaging 1.00
R4758:Spns1 UTSW 7 126370794 missense probably damaging 1.00
R5062:Spns1 UTSW 7 126374329 unclassified probably benign
R5371:Spns1 UTSW 7 126373764 unclassified probably benign
R5700:Spns1 UTSW 7 126372469 missense possibly damaging 0.95
R5973:Spns1 UTSW 7 126370323 missense probably damaging 1.00
R5985:Spns1 UTSW 7 126376730 missense probably benign 0.37
R6660:Spns1 UTSW 7 126375065 critical splice donor site probably null
R7175:Spns1 UTSW 7 126373789 missense probably damaging 0.98
R8051:Spns1 UTSW 7 126372536 missense probably benign 0.37
Z1177:Spns1 UTSW 7 126372410 critical splice donor site probably null
Z1177:Spns1 UTSW 7 126372411 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGGAGCTGGGAGATATC -3'
(R):5'- CTCATCCAGCTTAGCTTTGGG -3'

Sequencing Primer
(F):5'- GGAGATATCCCAGGGCTTCCTTC -3'
(R):5'- ATCCAGCTTAGCTTTGGGTCTGTC -3'
Posted On2015-02-19