Incidental Mutation 'R3552:Megf11'
ID269001
Institutional Source Beutler Lab
Gene Symbol Megf11
Ensembl Gene ENSMUSG00000036466
Gene Namemultiple EGF-like-domains 11
Synonyms
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R3552 (G1)
Quality Score195
Status Validated
Chromosome9
Chromosomal Location64385626-64709205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64695463 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 862 (D862G)
Ref Sequence ENSEMBL: ENSMUSP00000091349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068967] [ENSMUST00000093829] [ENSMUST00000118485] [ENSMUST00000164113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068967
AA Change: D936G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065353
Gene: ENSMUSG00000036466
AA Change: D936G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093829
AA Change: D862G

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091349
Gene: ENSMUSG00000036466
AA Change: D862G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF_Lam 114 153 9.55e-3 SMART
EGF_Lam 157 196 2e-5 SMART
EGF 195 227 5.57e-4 SMART
EGF_Lam 243 282 1.26e-2 SMART
EGF_Lam 286 326 2.52e-2 SMART
EGF_Lam 330 371 4.16e-3 SMART
EGF 370 402 6.21e-2 SMART
EGF 413 445 4.1e-2 SMART
EGF 456 488 7.02e-1 SMART
EGF_Lam 504 543 1.43e-1 SMART
EGF_Lam 547 586 5.04e-2 SMART
EGF 585 619 8.52e0 SMART
EGF 630 662 9.41e-2 SMART
EGF_Lam 678 717 2.99e-4 SMART
EGF 716 748 1.14e0 SMART
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 821 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118485
SMART Domains Protein: ENSMUSP00000114035
Gene: ENSMUSG00000036466

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124881
SMART Domains Protein: ENSMUSP00000120514
Gene: ENSMUSG00000036466

DomainStartEndE-ValueType
EGF_like 3 36 2.79e0 SMART
EGF 35 67 4.1e-2 SMART
EGF 78 110 7.02e-1 SMART
EGF_Lam 126 165 1.43e-1 SMART
EGF 164 196 1.64e-1 SMART
EGF_Lam 212 251 2.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153934
Predicted Effect probably benign
Transcript: ENSMUST00000164113
AA Change: D893G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128672
Gene: ENSMUSG00000036466
AA Change: D893G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF_Lam 709 748 2.99e-4 SMART
EGF 747 779 1.14e0 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of horizontal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Megf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Megf11 APN 9 64508727 missense probably damaging 1.00
IGL01285:Megf11 APN 9 64660446 missense probably damaging 1.00
IGL01309:Megf11 APN 9 64681416 missense probably benign 0.01
IGL01953:Megf11 APN 9 64690088 missense probably damaging 1.00
IGL02341:Megf11 APN 9 64544620 missense probably damaging 1.00
IGL02407:Megf11 APN 9 64680249 missense probably damaging 1.00
IGL02621:Megf11 APN 9 64693932 missense probably benign 0.07
R0277:Megf11 UTSW 9 64691350 critical splice donor site probably null
R0386:Megf11 UTSW 9 64640078 missense probably damaging 1.00
R1354:Megf11 UTSW 9 64653177 missense probably benign 0.00
R1709:Megf11 UTSW 9 64695412 missense probably damaging 1.00
R1865:Megf11 UTSW 9 64680299 missense probably benign 0.39
R1895:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R1946:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R2221:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R2223:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R4641:Megf11 UTSW 9 64690125 missense possibly damaging 0.93
R4746:Megf11 UTSW 9 64508745 missense probably damaging 1.00
R5594:Megf11 UTSW 9 64686473 missense probably damaging 1.00
R5716:Megf11 UTSW 9 64506110 missense possibly damaging 0.72
R5898:Megf11 UTSW 9 64685964 missense probably damaging 1.00
R5960:Megf11 UTSW 9 64660449 missense probably benign 0.00
R6372:Megf11 UTSW 9 64706625 missense probably damaging 1.00
R6811:Megf11 UTSW 9 64544641 missense probably damaging 0.99
R6868:Megf11 UTSW 9 64680309 missense probably damaging 1.00
R6980:Megf11 UTSW 9 64705850 missense probably damaging 1.00
R6984:Megf11 UTSW 9 64686452 missense probably benign
R7155:Megf11 UTSW 9 64647951 missense probably null 1.00
R7638:Megf11 UTSW 9 64679253 missense probably damaging 0.96
R7643:Megf11 UTSW 9 64706632 missense probably damaging 1.00
R7688:Megf11 UTSW 9 64691864 missense possibly damaging 0.92
R7840:Megf11 UTSW 9 64695427 missense possibly damaging 0.94
V5088:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
Z1088:Megf11 UTSW 9 64660476 missense probably damaging 1.00
Z1177:Megf11 UTSW 9 64680326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCTTTGCTGGGGATAC -3'
(R):5'- TAGAGCTTGTCTCCATACATGTTC -3'

Sequencing Primer
(F):5'- TGCATAACCCCAGCATTAGTTTGG -3'
(R):5'- CTTTCCCTGTTATGTGATTCAGAG -3'
Posted On2015-02-19