Mutagenetix > Incidental Mutations

Incidental Mutation 'R3552:Washc4'

269004

Institutional Source

Beutler Lab

Gene Symbol

Washc4

Ensembl Gene

ENSMUSG00000034560

Gene Name

WASH complex subunit 4

Synonyms

A230046K03Rik

MMRRC Submission

040669-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.818) question?

Stock #

R3552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83543752-83596473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83546856 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 45 (I45V)

Ref Sequence

ENSEMBL: ENSMUSP00000151417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]

Predicted Effect

probably benign
Transcript: ENSMUST00000038388
AA Change: I45V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: I45V

Domain	Start	End	E-Value	Type
Pfam:WASH-7_N	32	604	4.8e-245	PFAM
Pfam:WASH-7_mid	605	949	7.9e-176	PFAM
low complexity region	954	965	N/A	INTRINSIC
Pfam:WASH-7_C	966	1135	9.1e-76	PFAM
low complexity region	1138	1156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217842
AA Change: I45V

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Esrrg	G	A	1: 188,150,190	V215I	probably benign	Het
Evx1	A	T	6: 52,316,923	S359C	probably damaging	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Rbl1	A	T	2: 157,195,585	I214K	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnrc6b	T	G	15: 80,880,247	L650W	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp735	C	A	11: 73,711,241	S337*	probably null	Het

Other mutations in Washc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Washc4	APN	10	83550883	missense	probably benign	0.07
IGL01370:Washc4	APN	10	83558830	missense	probably damaging	0.98
IGL01524:Washc4	APN	10	83576132	missense	probably benign	0.37
IGL01682:Washc4	APN	10	83580306	missense	possibly damaging	0.93
IGL01973:Washc4	APN	10	83556109	missense	probably damaging	0.99
IGL02002:Washc4	APN	10	83579543	missense	possibly damaging	0.95
IGL02020:Washc4	APN	10	83564472	missense	probably damaging	0.97
IGL02230:Washc4	APN	10	83581369	missense	probably benign	0.00
IGL02421:Washc4	APN	10	83579550	missense	probably damaging	0.98
IGL02514:Washc4	APN	10	83570083	missense	probably damaging	0.98
IGL02619:Washc4	APN	10	83558853	missense	possibly damaging	0.84
IGL02852:Washc4	APN	10	83583309	missense	possibly damaging	0.95
IGL02870:Washc4	APN	10	83585876	missense	probably benign
IGL03181:Washc4	APN	10	83591019	missense	probably damaging	1.00
IGL03247:Washc4	APN	10	83564463	missense	probably benign	0.02
R0458:Washc4	UTSW	10	83546799	missense	possibly damaging	0.70
R0462:Washc4	UTSW	10	83556913	missense	probably benign	0.00
R0471:Washc4	UTSW	10	83558734	splice site	probably benign
R1144:Washc4	UTSW	10	83580330	missense	probably damaging	0.97
R1560:Washc4	UTSW	10	83556109	missense	probably damaging	0.99
R1789:Washc4	UTSW	10	83579525	missense	possibly damaging	0.92
R1819:Washc4	UTSW	10	83550884	missense	probably benign	0.08
R2421:Washc4	UTSW	10	83579521	missense	probably damaging	0.97
R2882:Washc4	UTSW	10	83579501	missense	possibly damaging	0.93
R2902:Washc4	UTSW	10	83554763	nonsense	probably null
R3436:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R3437:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R4646:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4647:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4648:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4732:Washc4	UTSW	10	83574479	missense	probably benign
R4733:Washc4	UTSW	10	83574479	missense	probably benign
R4750:Washc4	UTSW	10	83591052	missense	probably damaging	0.99
R4835:Washc4	UTSW	10	83579512	missense	possibly damaging	0.93
R5024:Washc4	UTSW	10	83583336	missense	possibly damaging	0.71
R5055:Washc4	UTSW	10	83556907	missense	probably damaging	0.99
R5414:Washc4	UTSW	10	83556103	missense	possibly damaging	0.95
R5423:Washc4	UTSW	10	83579554	missense	possibly damaging	0.71
R5428:Washc4	UTSW	10	83574522	missense	probably benign	0.00
R5506:Washc4	UTSW	10	83581337	missense	probably damaging	0.97
R5540:Washc4	UTSW	10	83573793	missense	probably damaging	0.99
R5667:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5671:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5777:Washc4	UTSW	10	83555605	missense	probably damaging	1.00
R6369:Washc4	UTSW	10	83574444	missense	probably damaging	1.00
R6370:Washc4	UTSW	10	83571362	missense	possibly damaging	0.85
R6500:Washc4	UTSW	10	83558823	missense	probably damaging	1.00
R6645:Washc4	UTSW	10	83572195	nonsense	probably null
R6657:Washc4	UTSW	10	83558618	missense	possibly damaging	0.92
R6829:Washc4	UTSW	10	83560516	missense	probably damaging	0.97
R6862:Washc4	UTSW	10	83558893	missense	possibly damaging	0.92
R6899:Washc4	UTSW	10	83576055	missense	probably benign	0.07
R7144:Washc4	UTSW	10	83573774	critical splice acceptor site	probably null
R7163:Washc4	UTSW	10	83591033	missense	probably damaging	0.99
R7477:Washc4	UTSW	10	83574443	missense	probably damaging	0.99
R7900:Washc4	UTSW	10	83573773	splice site	probably null
R8491:Washc4	UTSW	10	83576123	missense	probably benign	0.24
R8791:Washc4	UTSW	10	83550884	missense	probably benign	0.08
R8804:Washc4	UTSW	10	83572151	missense	probably damaging	0.99
X0017:Washc4	UTSW	10	83591143	missense	probably damaging	1.00
X0066:Washc4	UTSW	10	83558829	frame shift	probably null
Z1088:Washc4	UTSW	10	83576741	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CGAGAAGTGAGGTATTCCCTAG -3'
(R):5'- AACATCACAAGAGGTAGTATGCC -3'

Sequencing Primer
(F):5'- GAAGCTAGTATTCTGCCG -3'
(R):5'- AAGAGGTAGTATGCCCTAAAATAAAC -3'

Posted On

2015-02-19