Mutagenetix > Incidental Mutation

Incidental Mutation 'R3552:Zfp735'

269011

Institutional Source

Beutler Lab

Gene Symbol

Zfp735

Ensembl Gene

ENSMUSG00000060630

Gene Name

zinc finger protein 735

Synonyms

1700012C15Rik

MMRRC Submission

040669-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73688778-73713798 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 73711241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 337 (S337*)

Ref Sequence

ENSEMBL: ENSMUSP00000079269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080407]

AlphaFold

B1ARH2

Predicted Effect

probably null
Transcript: ENSMUST00000080407
AA Change: S337*

SMART Domains

Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: S337*

Domain	Start	End	E-Value	Type
KRAB	8	68	2.2e-34	SMART
ZnF_C2H2	483	505	4.38e1	SMART
ZnF_C2H2	511	533	2.67e-1	SMART
ZnF_C2H2	539	561	1.81e1	SMART
ZnF_C2H2	567	589	1.5e-4	SMART
ZnF_C2H2	595	617	4.87e-4	SMART
ZnF_C2H2	623	645	4.24e-4	SMART
ZnF_C2H2	651	673	2.27e-4	SMART
ZnF_C2H2	679	701	7.49e-5	SMART
ZnF_C2H2	707	729	4.87e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149560

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Esrrg	G	A	1: 188,150,190	V215I	probably benign	Het
Evx1	A	T	6: 52,316,923	S359C	probably damaging	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Rbl1	A	T	2: 157,195,585	I214K	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnrc6b	T	G	15: 80,880,247	L650W	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Washc4	A	G	10: 83,546,856	I45V	probably benign	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het

Other mutations in Zfp735

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Zfp735	APN	11	73711366	missense	possibly damaging	0.86
IGL00798:Zfp735	APN	11	73711560	missense	possibly damaging	0.72
IGL01642:Zfp735	APN	11	73710479	missense	possibly damaging	0.73
IGL01684:Zfp735	APN	11	73690365	missense	possibly damaging	0.86
IGL02096:Zfp735	APN	11	73711428	missense	probably benign	0.01
IGL02238:Zfp735	APN	11	73710493	missense	probably benign	0.00
IGL02505:Zfp735	APN	11	73689800	missense	probably benign	0.03
IGL02740:Zfp735	APN	11	73710586	missense	possibly damaging	0.53
IGL02957:Zfp735	APN	11	73710929	missense	probably benign	0.00
bananaquit	UTSW	11	73710586	nonsense	probably null
bescher	UTSW	11	73712153	missense	possibly damaging	0.93
Galvanic	UTSW	11	73711678	nonsense	probably null
grassquit	UTSW	11	73712203	missense	possibly damaging	0.66
R0114:Zfp735	UTSW	11	73710662	missense	probably benign	0.33
R0217:Zfp735	UTSW	11	73711286	missense	possibly damaging	0.73
R0943:Zfp735	UTSW	11	73712083	missense	probably benign	0.04
R1421:Zfp735	UTSW	11	73710697	missense	probably benign
R1460:Zfp735	UTSW	11	73712333	missense	possibly damaging	0.73
R1493:Zfp735	UTSW	11	73710479	missense	possibly damaging	0.73
R1517:Zfp735	UTSW	11	73710644	missense	probably benign
R1676:Zfp735	UTSW	11	73711475	missense	possibly damaging	0.53
R1709:Zfp735	UTSW	11	73711763	missense	probably benign	0.01
R1871:Zfp735	UTSW	11	73710586	nonsense	probably null
R1931:Zfp735	UTSW	11	73711851	missense	possibly damaging	0.69
R2219:Zfp735	UTSW	11	73711025	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711396	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711397	nonsense	probably null
R3856:Zfp735	UTSW	11	73711456	missense	probably benign	0.01
R3925:Zfp735	UTSW	11	73711124	missense	probably benign	0.33
R4572:Zfp735	UTSW	11	73689785	missense	probably benign	0.02
R4585:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4586:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4619:Zfp735	UTSW	11	73711205	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711855	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711856	missense	probably damaging	0.98
R5435:Zfp735	UTSW	11	73712113	missense	possibly damaging	0.72
R5489:Zfp735	UTSW	11	73710593	nonsense	probably null
R5516:Zfp735	UTSW	11	73710814	missense	probably benign
R5654:Zfp735	UTSW	11	73712138	missense	possibly damaging	0.71
R5990:Zfp735	UTSW	11	73690348	missense	possibly damaging	0.70
R6332:Zfp735	UTSW	11	73711678	nonsense	probably null
R6427:Zfp735	UTSW	11	73690314	missense	possibly damaging	0.73
R6460:Zfp735	UTSW	11	73711652	missense	probably benign	0.33
R6820:Zfp735	UTSW	11	73688957	start codon destroyed	probably null	0.01
R6831:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6833:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6834:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6897:Zfp735	UTSW	11	73711054	missense	probably benign	0.08
R6941:Zfp735	UTSW	11	73690333	missense	probably benign	0.33
R7335:Zfp735	UTSW	11	73711553	missense	possibly damaging	0.47
R7366:Zfp735	UTSW	11	73712153	missense	possibly damaging	0.93
R7474:Zfp735	UTSW	11	73711176	missense	possibly damaging	0.72
R7487:Zfp735	UTSW	11	73690328	missense	possibly damaging	0.53
R7583:Zfp735	UTSW	11	73711107	missense	possibly damaging	0.86
R7866:Zfp735	UTSW	11	73710803	missense	probably benign	0.00
R8005:Zfp735	UTSW	11	73712314	nonsense	probably null
R8500:Zfp735	UTSW	11	73710985	missense	possibly damaging	0.53
R8551:Zfp735	UTSW	11	73712296	missense	probably benign	0.06
R8754:Zfp735	UTSW	11	73712174	missense	possibly damaging	0.85
R8769:Zfp735	UTSW	11	73690301	missense	possibly damaging	0.53
R8794:Zfp735	UTSW	11	73712203	missense	possibly damaging	0.66
R8835:Zfp735	UTSW	11	73710866	missense	possibly damaging	0.53
R8869:Zfp735	UTSW	11	73711684	missense	possibly damaging	0.53
R8969:Zfp735	UTSW	11	73711873	missense	possibly damaging	0.83
R9072:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9073:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9193:Zfp735	UTSW	11	73689774	missense	possibly damaging	0.71
R9355:Zfp735	UTSW	11	73711536	missense	probably benign	0.01
R9414:Zfp735	UTSW	11	73711197	nonsense	probably null
R9456:Zfp735	UTSW	11	73711577	missense	possibly damaging	0.53
R9573:Zfp735	UTSW	11	73712110	missense	possibly damaging	0.67
R9647:Zfp735	UTSW	11	73689774	missense	probably damaging	0.98
R9710:Zfp735	UTSW	11	73710980	missense	possibly damaging	0.86
Z1176:Zfp735	UTSW	11	73710815	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGCAGTTGTGGGAACTCC -3'
(R):5'- ACTTATCATATCCCGGGGCCAG -3'

Sequencing Primer
(F):5'- GGCTACATTAAAAACCCCTTTCTG -3'
(R):5'- TATCCCGGGGCCAGGAAAAG -3'

Posted On

2015-02-19