Mutagenetix > Incidental Mutations

Incidental Mutation 'R3552:Tnrc6b'

269019

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

040669-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.272) question?

Stock #

R3552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 80880247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Tryptophan at position 650 (L650W)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: L650W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: L650W

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228320

Meta Mutation Damage Score

0.5767

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Esrrg	G	A	1: 188,150,190	V215I	probably benign	Het
Evx1	A	T	6: 52,316,923	S359C	probably damaging	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Rbl1	A	T	2: 157,195,585	I214K	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Washc4	A	G	10: 83,546,856	I45V	probably benign	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp735	C	A	11: 73,711,241	S337*	probably null	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AATTCTAGCACTGGAGCATGG -3'
(R):5'- TTTCCACTCTGTCGAGGCTG -3'

Sequencing Primer
(F):5'- TCCCTGAAAACCAAGGCAATG -3'
(R):5'- TCTGTCGAGGCTGAGAGCTC -3'

Posted On

2015-02-19