Incidental Mutation 'R3552:Atp13a5'
ID269021
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene NameATPase type 13A5
SynonymsC630015F21Rik
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29231851-29378732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29310766 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 452 (D452V)
Ref Sequence ENSEMBL: ENSMUSP00000121208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373]
Predicted Effect probably damaging
Transcript: ENSMUST00000075806
AA Change: D497V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939
AA Change: D497V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142681
AA Change: D497V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939
AA Change: D497V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143373
AA Change: D452V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939
AA Change: D452V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Meta Mutation Damage Score 0.5455 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1515:Atp13a5 UTSW 16 29333974 missense probably benign 0.23
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4632:Atp13a5 UTSW 16 29348719 missense probably damaging 1.00
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5598:Atp13a5 UTSW 16 29257077 intron probably benign
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7070:Atp13a5 UTSW 16 29334061 missense possibly damaging 0.88
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
R7781:Atp13a5 UTSW 16 29297408 missense probably benign 0.00
R7876:Atp13a5 UTSW 16 29321748 missense possibly damaging 0.93
R8358:Atp13a5 UTSW 16 29348987 missense probably damaging 1.00
R8427:Atp13a5 UTSW 16 29349002 missense possibly damaging 0.65
R8435:Atp13a5 UTSW 16 29280929 critical splice donor site probably null
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Z1177:Atp13a5 UTSW 16 29280969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCGACTTTCTTTGTCTGACTTG -3'
(R):5'- CACAGTGTCATGTGGAAGCC -3'

Sequencing Primer
(F):5'- TAATTGGGAGCCAGTGTG -3'
(R):5'- TCCTGGGGATGCTGCACTAAC -3'
Posted On2015-02-19