Incidental Mutation 'R3552:Shtn1'
ID269027
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58975038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 615 (Y615C)
Ref Sequence ENSEMBL: ENSMUSP00000041378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000054280] [ENSMUST00000163821] [ENSMUST00000200910] [ENSMUST00000202382]
Predicted Effect probably benign
Transcript: ENSMUST00000047511
AA Change: Y615C

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: Y615C

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054280
SMART Domains Protein: ENSMUSP00000062584
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 69 264 1.06e-20 SMART
Enolase_C 276 585 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163821
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200910
SMART Domains Protein: ENSMUSP00000144272
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 68 263 1.06e-20 SMART
Enolase_C 275 584 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201123
Predicted Effect probably benign
Transcript: ENSMUST00000202382
SMART Domains Protein: ENSMUSP00000144656
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_N 1 88 1e-22 BLAST
Enolase_C 100 409 2.1e-45 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1212:Shtn1 UTSW 19 59050890 missense probably damaging 1.00
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5245:Shtn1 UTSW 19 59032220 missense possibly damaging 0.90
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
R7487:Shtn1 UTSW 19 59003860 missense probably damaging 0.99
R7496:Shtn1 UTSW 19 59028184 missense probably damaging 1.00
R7889:Shtn1 UTSW 19 59003896 missense probably damaging 0.99
R8209:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8226:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8290:Shtn1 UTSW 19 58999894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACCCAGAAGATGCATTTTGC -3'
(R):5'- CCTCCCAGTAAAGGTGGATAC -3'

Sequencing Primer
(F):5'- CCCAGAAGATGCATTTTGCTAAACAG -3'
(R):5'- TACAGGAGAAAATGTGTGGGC -3'
Posted On2015-02-19