Incidental Mutation 'R3605:Traf2'
ID269032
Institutional Source Beutler Lab
Gene Symbol Traf2
Ensembl Gene ENSMUSG00000026942
Gene NameTNF receptor-associated factor 2
Synonyms
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3605 (G1)
Quality Score149
Status Validated
Chromosome2
Chromosomal Location25517982-25546940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25530415 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000109872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028311] [ENSMUST00000114234]
Predicted Effect probably benign
Transcript: ENSMUST00000028311
AA Change: T134A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028311
Gene: ENSMUSG00000026942
AA Change: T134A

DomainStartEndE-ValueType
RING 34 72 3.19e-3 SMART
Pfam:zf-TRAF 178 235 1.9e-22 PFAM
MATH 356 478 3.09e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114234
AA Change: T141A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109872
Gene: ENSMUSG00000026942
AA Change: T141A

DomainStartEndE-ValueType
RING 34 79 3.42e-2 SMART
Pfam:zf-TRAF 185 242 2.4e-23 PFAM
Pfam:TRAF_BIRC3_bd 274 337 1.6e-34 PFAM
MATH 363 485 3.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151742
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Increased lethaltiy is observed with homozygous null mice. Offspring are runted and exhibit atrophic thymii and spleens with reduced numbers of lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Traf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Traf2 APN 2 25520451 nonsense probably null
IGL01010:Traf2 APN 2 25520438 nonsense probably null
IGL01063:Traf2 APN 2 25524919 missense probably benign 0.00
IGL01146:Traf2 APN 2 25524919 missense probably benign 0.00
IGL02114:Traf2 APN 2 25524992 missense possibly damaging 0.50
IGL02319:Traf2 APN 2 25536683 missense probably damaging 0.99
accessory UTSW 2 25537088 frame shift probably null
parallel UTSW 2 25530415 missense probably benign 0.02
R0116:Traf2 UTSW 2 25519609 missense probably damaging 1.00
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R1741:Traf2 UTSW 2 25524483 missense probably damaging 1.00
R3607:Traf2 UTSW 2 25530415 missense probably benign 0.02
R4940:Traf2 UTSW 2 25530288 missense probably null 0.48
R5296:Traf2 UTSW 2 25520440 missense probably damaging 1.00
R5784:Traf2 UTSW 2 25539037 missense probably benign 0.32
R7536:Traf2 UTSW 2 25537106 missense possibly damaging 0.63
R7639:Traf2 UTSW 2 25537088 frame shift probably null
Z1176:Traf2 UTSW 2 25537144 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTAAGCAAACTTCAACCATGGC -3'
(R):5'- GGCCTGTGTCTATACAGTGG -3'

Sequencing Primer
(F):5'- CAGTAAATGCTAGGCGACTGC -3'
(R):5'- CCTGTGTCTATACAGTGGTTCTGAG -3'
Posted On2015-02-19