Incidental Mutation 'R3605:Olfr1312'
ID 269035
Institutional Source Beutler Lab
Gene Symbol Olfr1312
Ensembl Gene ENSMUSG00000074947
Gene Name olfactory receptor 1312
Synonyms GA_x6K02T2Q125-73090482-73089529, MOR245-20
MMRRC Submission 040670-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R3605 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 112038068-112050238 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112042823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 70 (I70F)
Ref Sequence ENSEMBL: ENSMUSP00000149430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099600] [ENSMUST00000213582] [ENSMUST00000213961] [ENSMUST00000215531]
AlphaFold Q8VF10
Predicted Effect probably benign
Transcript: ENSMUST00000099600
AA Change: I70F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097195
Gene: ENSMUSG00000074947
AA Change: I70F

DomainStartEndE-ValueType
Pfam:7tm_4 27 302 1.6e-43 PFAM
Pfam:7tm_1 38 284 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213582
AA Change: I70F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213961
AA Change: I70F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215531
AA Change: I70F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Olfr1312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr1312 APN 2 112042371 missense probably benign 0.00
IGL01650:Olfr1312 APN 2 112042375 missense possibly damaging 0.84
IGL02390:Olfr1312 APN 2 112042711 missense possibly damaging 0.84
IGL03392:Olfr1312 APN 2 112042976 missense probably benign 0.00
R1170:Olfr1312 UTSW 2 112042215 missense probably benign 0.45
R1620:Olfr1312 UTSW 2 112042246 missense probably benign 0.07
R2083:Olfr1312 UTSW 2 112042553 missense probably benign 0.05
R4182:Olfr1312 UTSW 2 112042528 missense probably damaging 1.00
R5739:Olfr1312 UTSW 2 112042783 missense probably damaging 0.99
R6321:Olfr1312 UTSW 2 112042768 missense probably benign 0.07
R7231:Olfr1312 UTSW 2 112042366 missense probably damaging 1.00
R7365:Olfr1312 UTSW 2 112043014 missense possibly damaging 0.95
R7673:Olfr1312 UTSW 2 112042580 missense probably benign
R7978:Olfr1312 UTSW 2 112042178 missense possibly damaging 0.92
R8112:Olfr1312 UTSW 2 112042637 missense probably damaging 1.00
R8167:Olfr1312 UTSW 2 112042444 missense possibly damaging 0.91
R8356:Olfr1312 UTSW 2 112042598 missense probably damaging 0.99
R8799:Olfr1312 UTSW 2 112042183 missense probably damaging 1.00
R9186:Olfr1312 UTSW 2 112042750 missense probably damaging 1.00
R9658:Olfr1312 UTSW 2 112042478 missense probably damaging 1.00
Z1177:Olfr1312 UTSW 2 112042655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGATGCACACCCTTGGG -3'
(R):5'- GAGTTTGTATTCCTGGGACTCACC -3'

Sequencing Primer
(F):5'- ACCCTTGGGCTCATAATGGTCAG -3'
(R):5'- GTATTCCTGGGACTCACCAATTC -3'
Posted On 2015-02-19