Incidental Mutation 'R3605:Flrt3'
ID269036
Institutional Source Beutler Lab
Gene Symbol Flrt3
Ensembl Gene ENSMUSG00000051379
Gene Namefibronectin leucine rich transmembrane protein 3
Synonyms5530600M07Rik, C430047I10Rik
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140650914-140671469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140661367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 114 (N114Y)
Ref Sequence ENSEMBL: ENSMUSP00000105684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056760] [ENSMUST00000078027] [ENSMUST00000110057] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably damaging
Transcript: ENSMUST00000056760
AA Change: N114Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053399
Gene: ENSMUSG00000051379
AA Change: N114Y

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110057
AA Change: N114Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105684
Gene: ENSMUSG00000051379
AA Change: N114Y

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172544
Meta Mutation Damage Score 0.9347 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, abnormal embryonic tissue development, disrupted head formation, cardia bifida and abnormal ventral wall closure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Flrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Flrt3 APN 2 140660688 missense probably damaging 0.99
IGL02292:Flrt3 APN 2 140660125 missense probably damaging 1.00
R0030:Flrt3 UTSW 2 140660317 missense probably damaging 1.00
R1487:Flrt3 UTSW 2 140660934 missense probably damaging 1.00
R2061:Flrt3 UTSW 2 140661453 missense probably damaging 1.00
R2115:Flrt3 UTSW 2 140661503 missense probably damaging 1.00
R2326:Flrt3 UTSW 2 140661391 missense possibly damaging 0.50
R3113:Flrt3 UTSW 2 140661534 missense probably benign 0.03
R4366:Flrt3 UTSW 2 140660407 missense probably damaging 0.99
R4702:Flrt3 UTSW 2 140661655 missense probably benign
R4799:Flrt3 UTSW 2 140660166 missense probably damaging 1.00
R5085:Flrt3 UTSW 2 140660257 missense probably damaging 0.99
R5100:Flrt3 UTSW 2 140671384 start gained probably null
R5109:Flrt3 UTSW 2 140660743 missense possibly damaging 0.51
R5635:Flrt3 UTSW 2 140660500 missense probably damaging 1.00
R5982:Flrt3 UTSW 2 140660916 missense possibly damaging 0.95
R6117:Flrt3 UTSW 2 140660445 missense possibly damaging 0.46
R6213:Flrt3 UTSW 2 140661165 missense probably damaging 1.00
R6246:Flrt3 UTSW 2 140659801 missense probably damaging 1.00
R6746:Flrt3 UTSW 2 140660025 missense probably damaging 0.99
R6854:Flrt3 UTSW 2 140660718 missense probably damaging 1.00
R7000:Flrt3 UTSW 2 140660884 nonsense probably null
R7221:Flrt3 UTSW 2 140661170 missense probably damaging 0.99
R7388:Flrt3 UTSW 2 140661752 critical splice acceptor site probably null
R7444:Flrt3 UTSW 2 140660467 missense probably benign 0.00
R7526:Flrt3 UTSW 2 140660206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATAGTCCTGGGCAAGCC -3'
(R):5'- AACGATCGCTCTCTGACATC -3'

Sequencing Primer
(F):5'- CCCCCGGGATTGTGCTAAG -3'
(R):5'- CTGACATCCATTCCAGTGGG -3'
Posted On2015-02-19