Incidental Mutation 'R3605:Nxt1'
ID269037
Institutional Source Beutler Lab
Gene Symbol Nxt1
Ensembl Gene ENSMUSG00000036992
Gene NameNTF2-related export protein 1
Synonyms
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148672601-148676027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148675479 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 47 (W47R)
Ref Sequence ENSEMBL: ENSMUSP00000105587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047177] [ENSMUST00000109961]
Predicted Effect probably damaging
Transcript: ENSMUST00000047177
AA Change: W47R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038329
Gene: ENSMUSG00000036992
AA Change: W47R

DomainStartEndE-ValueType
Pfam:NTF2 16 135 2.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109961
AA Change: W47R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105587
Gene: ENSMUSG00000036992
AA Change: W47R

DomainStartEndE-ValueType
Pfam:NTF2 16 135 1e-30 PFAM
Meta Mutation Damage Score 0.9604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the nuclear envelope. It has protein similarity to nuclear transport factor 2. This protein functions as a nuclear export factor in both RAN (Ras-related nuclear protein)- and CRM1 (required for chromosome region maintenance)-dependent pathways. It is found to stimulate the export of U1 snRNA in RAN- and CRM1-dependent pathways and the export of tRNA and mRNA in a CRM1-independent pathway. The encoded protein heterodimerizes with Tap protein and may regulate the ability of Tap protein to mediate nuclear mRNA export. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Nxt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Nxt1 APN 2 148675396 missense probably damaging 0.97
IGL02103:Nxt1 APN 2 148675644 nonsense probably null
IGL02958:Nxt1 APN 2 148675772 utr 3 prime probably benign
R0139:Nxt1 UTSW 2 148675470 missense probably benign 0.01
R4075:Nxt1 UTSW 2 148675732 missense probably damaging 0.98
R4235:Nxt1 UTSW 2 148675347 missense probably benign 0.28
R5685:Nxt1 UTSW 2 148675753 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAGTCCCTGGATCCCTAAG -3'
(R):5'- AGTTCTGGTTGAAGTCCCGC -3'

Sequencing Primer
(F):5'- CTAAGGAGGAGGCGCTCAG -3'
(R):5'- GAAGTCCCGCTGTTTGTTGCC -3'
Posted On2015-02-19