Incidental Mutation 'R3605:Bpifb1'
ID269038
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene NameBPI fold containing family B, member 1
SynonymsLPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154190818-154220369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154211565 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 242 (N242K)
Ref Sequence ENSEMBL: ENSMUSP00000080501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028987
AA Change: N242K

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: N242K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081816
AA Change: N242K

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: N242K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123017
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0058:Bpifb1 UTSW 2 154206540 missense possibly damaging 0.54
R0269:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4745:Bpifb1 UTSW 2 154211581 nonsense probably null
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R5724:Bpifb1 UTSW 2 154204792 missense probably benign
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7246:Bpifb1 UTSW 2 154207092 missense probably damaging 1.00
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTGAAGTGGTCCCTGCAATG -3'
(R):5'- AGACATGACGTTCTACCTGCTG -3'

Sequencing Primer
(F):5'- AATGGTTGCCATGGTTACTACC -3'
(R):5'- GCTGGCTTTCACAAGATGC -3'
Posted On2015-02-19