Incidental Mutation 'R3605:Ankrd35'
ID269042
Institutional Source Beutler Lab
Gene Symbol Ankrd35
Ensembl Gene ENSMUSG00000038354
Gene Nameankyrin repeat domain 35
Synonyms4732436F15Rik
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96670131-96691032 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 96682181 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 239 (Q239*)
Ref Sequence ENSEMBL: ENSMUSP00000047244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048427] [ENSMUST00000122960]
Predicted Effect probably null
Transcript: ENSMUST00000048427
AA Change: Q239*
SMART Domains Protein: ENSMUSP00000047244
Gene: ENSMUSG00000038354
AA Change: Q239*

DomainStartEndE-ValueType
ANK 53 82 4.03e-5 SMART
ANK 86 115 6.46e-4 SMART
ANK 119 148 4.36e-1 SMART
ANK 152 181 1.4e-4 SMART
ANK 185 214 2.25e-3 SMART
ANK 218 247 6.24e2 SMART
coiled coil region 294 339 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
coiled coil region 606 653 N/A INTRINSIC
coiled coil region 729 799 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 847 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130429
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Ankrd35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Ankrd35 APN 3 96683034 splice site probably null
IGL00896:Ankrd35 APN 3 96684276 missense probably damaging 1.00
IGL01565:Ankrd35 APN 3 96684785 missense probably damaging 0.99
IGL01837:Ankrd35 APN 3 96680666 missense probably damaging 1.00
IGL02605:Ankrd35 APN 3 96681072 splice site probably null
IGL02819:Ankrd35 APN 3 96690208 missense possibly damaging 0.80
IGL02994:Ankrd35 APN 3 96682991 splice site probably benign
IGL03083:Ankrd35 APN 3 96684801 missense probably damaging 1.00
IGL03105:Ankrd35 APN 3 96684057 missense probably benign
FR4304:Ankrd35 UTSW 3 96683847 utr 3 prime probably benign
FR4342:Ankrd35 UTSW 3 96683515 frame shift probably null
FR4737:Ankrd35 UTSW 3 96683849 utr 3 prime probably benign
R0003:Ankrd35 UTSW 3 96684015 missense probably damaging 1.00
R0047:Ankrd35 UTSW 3 96684063 missense probably benign 0.00
R0551:Ankrd35 UTSW 3 96683960 missense probably benign 0.08
R1420:Ankrd35 UTSW 3 96684738 missense probably benign 0.13
R1455:Ankrd35 UTSW 3 96678155 missense probably damaging 1.00
R2201:Ankrd35 UTSW 3 96679248 missense possibly damaging 0.93
R3522:Ankrd35 UTSW 3 96685062 missense probably damaging 1.00
R4166:Ankrd35 UTSW 3 96679155 intron probably null
R4651:Ankrd35 UTSW 3 96684027 missense probably benign 0.00
R4668:Ankrd35 UTSW 3 96679208 missense probably damaging 1.00
R4916:Ankrd35 UTSW 3 96684122 missense probably benign
R4921:Ankrd35 UTSW 3 96684824 missense possibly damaging 0.61
R4953:Ankrd35 UTSW 3 96683673 missense possibly damaging 0.56
R5180:Ankrd35 UTSW 3 96680473 missense probably damaging 1.00
R5583:Ankrd35 UTSW 3 96684903 missense probably damaging 1.00
R5604:Ankrd35 UTSW 3 96684899 missense probably benign 0.02
R5613:Ankrd35 UTSW 3 96683018 missense possibly damaging 0.76
R6165:Ankrd35 UTSW 3 96683307 missense possibly damaging 0.93
R6413:Ankrd35 UTSW 3 96684813 missense probably damaging 0.96
R6711:Ankrd35 UTSW 3 96683468 nonsense probably null
R6834:Ankrd35 UTSW 3 96683283 missense possibly damaging 0.68
R6841:Ankrd35 UTSW 3 96670426 missense probably damaging 1.00
R7028:Ankrd35 UTSW 3 96683334 missense possibly damaging 0.92
R7396:Ankrd35 UTSW 3 96683497 missense probably damaging 1.00
R7425:Ankrd35 UTSW 3 96684788 missense not run
R7815:Ankrd35 UTSW 3 96684801 missense probably damaging 1.00
R7887:Ankrd35 UTSW 3 96684900 missense probably damaging 1.00
R7970:Ankrd35 UTSW 3 96684900 missense probably damaging 1.00
Z1177:Ankrd35 UTSW 3 96683770 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGTGAGTGGAATTTCTGAAACC -3'
(R):5'- TGTTCCCAAAATGCAGCAGC -3'

Sequencing Primer
(F):5'- TGAGTGGAATTTCTGAAACCATGAG -3'
(R):5'- GCAGCACTGTAAAGCCTTG -3'
Posted On2015-02-19