Incidental Mutation 'R3605:Art2b'
ID269050
Institutional Source Beutler Lab
Gene Symbol Art2b
Ensembl Gene ENSMUSG00000030651
Gene NameADP-ribosyltransferase 2b
SynonymsRt6, Rt-6, Rt6-2, ART2.2
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101576970-101585600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101579945 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 249 (N249I)
Ref Sequence ENSEMBL: ENSMUSP00000147267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063920] [ENSMUST00000209526]
Predicted Effect probably benign
Transcript: ENSMUST00000063920
AA Change: N249I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065658
Gene: ENSMUSG00000030651
AA Change: N249I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ART 27 242 3.2e-87 PFAM
low complexity region 269 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209526
AA Change: N249I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Art2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Art2b APN 7 101580569 missense probably damaging 1.00
IGL03085:Art2b APN 7 101580578 missense probably damaging 1.00
R1488:Art2b UTSW 7 101580207 missense probably damaging 1.00
R1813:Art2b UTSW 7 101580029 missense probably benign 0.38
R1896:Art2b UTSW 7 101580029 missense probably benign 0.38
R1941:Art2b UTSW 7 101580317 missense probably damaging 1.00
R1944:Art2b UTSW 7 101579946 missense probably benign 0.00
R1967:Art2b UTSW 7 101580207 missense probably damaging 1.00
R2019:Art2b UTSW 7 101579987 missense probably benign 0.02
R4424:Art2b UTSW 7 101579922 missense probably benign 0.23
R4960:Art2b UTSW 7 101580230 missense probably damaging 1.00
R5658:Art2b UTSW 7 101580362 missense probably damaging 0.99
R6024:Art2b UTSW 7 101580380 missense probably benign 0.03
R6223:Art2b UTSW 7 101579951 missense possibly damaging 0.88
R6980:Art2b UTSW 7 101580473 missense probably benign 0.01
R7184:Art2b UTSW 7 101580451 missense probably benign 0.17
Z1176:Art2b UTSW 7 101578882 missense not run
Predicted Primers PCR Primer
(F):5'- TGTCAGGGCTACTCTGACTG -3'
(R):5'- TCATCAGAACCTGCTTGGGG -3'

Sequencing Primer
(F):5'- GATGTACCATTACTGCAGCACATGTC -3'
(R):5'- ACCTGCTTGGGGGTTAATATCAAAG -3'
Posted On2015-02-19