Incidental Mutation 'R3605:Cracr2b'
ID269052
Institutional Source Beutler Lab
Gene Symbol Cracr2b
Ensembl Gene ENSMUSG00000048200
Gene Namecalcium release activated channel regulator 2B
SynonymsEfcab4a, 6330520A15Rik
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3605 (G1)
Quality Score169
Status Validated
Chromosome7
Chromosomal Location141461094-141466613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141466146 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 370 (P370S)
Ref Sequence ENSEMBL: ENSMUSP00000055899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053670] [ENSMUST00000058746] [ENSMUST00000106000] [ENSMUST00000165194] [ENSMUST00000167491] [ENSMUST00000170879] [ENSMUST00000172215] [ENSMUST00000177840] [ENSMUST00000209892] [ENSMUST00000209988] [ENSMUST00000211071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053670
AA Change: P370S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200
AA Change: P370S

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058746
SMART Domains Protein: ENSMUSP00000061636
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect probably benign
Transcript: ENSMUST00000106000
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163833
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably benign
Transcript: ENSMUST00000170879
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171994
Predicted Effect probably benign
Transcript: ENSMUST00000172215
SMART Domains Protein: ENSMUSP00000132793
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177840
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209698
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210308
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211564
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Cracr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cracr2b APN 7 141465757 unclassified probably benign
IGL02092:Cracr2b APN 7 141464956 missense probably damaging 0.96
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0324:Cracr2b UTSW 7 141463746 missense probably damaging 1.00
R0453:Cracr2b UTSW 7 141464263 missense probably damaging 0.96
R0569:Cracr2b UTSW 7 141464935 unclassified probably benign
R1386:Cracr2b UTSW 7 141463568 missense probably damaging 1.00
R2061:Cracr2b UTSW 7 141465280 missense probably damaging 0.96
R3607:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R4674:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R4675:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R5401:Cracr2b UTSW 7 141466223 makesense probably null
R6174:Cracr2b UTSW 7 141464836 missense probably damaging 1.00
R7127:Cracr2b UTSW 7 141465782 missense possibly damaging 0.73
R7132:Cracr2b UTSW 7 141463738 missense probably benign 0.30
R7303:Cracr2b UTSW 7 141463202 unclassified probably benign
R7448:Cracr2b UTSW 7 141464205 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGCTCTGTAGTCCTCTTGAC -3'
(R):5'- TCTGAGGTTAGCTCCTTCAGG -3'

Sequencing Primer
(F):5'- TCTTGACTCAGGGAAGGCATCTC -3'
(R):5'- AGCTCCTTCAGGCATGGGATG -3'
Posted On2015-02-19