Incidental Mutation 'R3605:Tk2'
ID269053
Institutional Source Beutler Lab
Gene Symbol Tk2
Ensembl Gene ENSMUSG00000035824
Gene Namethymidine kinase 2, mitochondrial
Synonyms
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104226685-104248558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104231171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 181 (V181A)
Ref Sequence ENSEMBL: ENSMUSP00000148642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050211] [ENSMUST00000211995] [ENSMUST00000212209] [ENSMUST00000212275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050211
AA Change: V181A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053616
Gene: ENSMUSG00000035824
AA Change: V181A

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
Pfam:dNK 58 267 1.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212165
Predicted Effect probably benign
Transcript: ENSMUST00000212209
Predicted Effect possibly damaging
Transcript: ENSMUST00000212275
AA Change: V181A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212805
Meta Mutation Damage Score 0.4981 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]
PHENOTYPE: Knock-out mice die at 2-4 wks of age showing stunted growth, hypothermia, progressive mtDNA loss, aberrant myocardial fibers and altered adipose tissue structure. Knock-in mutant mice show encephalomyelopathy, impaired gait, mtDNA loss, altered mt dNTP pools and respiratory chain enzyme activities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Tk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Tk2 APN 8 104241138 missense probably damaging 1.00
IGL02525:Tk2 APN 8 104243400 missense probably benign 0.02
IGL03211:Tk2 APN 8 104243441 missense probably damaging 1.00
R0333:Tk2 UTSW 8 104248514 unclassified probably benign
R0691:Tk2 UTSW 8 104231192 missense probably benign 0.16
R1851:Tk2 UTSW 8 104248445 nonsense probably null
R3508:Tk2 UTSW 8 104231193 missense probably benign 0.00
R4161:Tk2 UTSW 8 104238833 missense probably benign 0.00
R5328:Tk2 UTSW 8 104229299 splice site probably null
R5546:Tk2 UTSW 8 104247683 missense possibly damaging 0.51
R6909:Tk2 UTSW 8 104236810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCATGGACAGAAGAACC -3'
(R):5'- TGTGGGCATCATCTGTGGAC -3'

Sequencing Primer
(F):5'- GAACCCCCTAAATGCTGCCTG -3'
(R):5'- ACACTATGCAACATGCTCTTGGTG -3'
Posted On2015-02-19