Incidental Mutation 'R3605:Lctl'
ID269057
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Namelactase-like
SynonymsE130104I05Rik, KLPH
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64117147-64138118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64133193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 473 (Y473H)
Ref Sequence ENSEMBL: ENSMUSP00000034969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000122091] [ENSMUST00000124020] [ENSMUST00000176299]
Predicted Effect probably damaging
Transcript: ENSMUST00000034969
AA Change: Y473H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: Y473H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118215
AA Change: Y314H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401
AA Change: Y314H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124020
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176848
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64133129 nonsense probably null
IGL03066:Lctl APN 9 64117735 start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64134848 unclassified probably benign
R0077:Lctl UTSW 9 64122107 start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64117698 utr 5 prime probably benign
R0335:Lctl UTSW 9 64118887 missense probably benign 0.00
R0391:Lctl UTSW 9 64122314 splice site probably benign
R1740:Lctl UTSW 9 64133107 missense probably damaging 1.00
R1866:Lctl UTSW 9 64131721 missense probably damaging 1.00
R2160:Lctl UTSW 9 64117767 missense probably benign 0.02
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R3607:Lctl UTSW 9 64133193 missense probably damaging 1.00
R4585:Lctl UTSW 9 64131600 missense probably damaging 1.00
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R5249:Lctl UTSW 9 64137914 missense probably benign
R7021:Lctl UTSW 9 64132793 splice site probably null
R7106:Lctl UTSW 9 64132837 missense probably benign 0.22
R7221:Lctl UTSW 9 64118935 nonsense probably null
R7265:Lctl UTSW 9 64126921 missense probably damaging 1.00
R7353:Lctl UTSW 9 64126967 missense probably damaging 1.00
R7501:Lctl UTSW 9 64131579 missense probably benign 0.00
R7615:Lctl UTSW 9 64122110 missense probably damaging 1.00
R7855:Lctl UTSW 9 64133216 missense possibly damaging 0.89
R7938:Lctl UTSW 9 64133216 missense possibly damaging 0.89
RF014:Lctl UTSW 9 64118930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTTCTGCGATGAGTGG -3'
(R):5'- CCCCTCCTTTGAAAGAAAGAAGTG -3'

Sequencing Primer
(F):5'- TCTGCGATGAGTGGAGAATCC -3'
(R):5'- CCTTTGAAAGAAAGAAGTGTGGTTC -3'
Posted On2015-02-19