Incidental Mutation 'R3605:Gabra6'
ID269059
Institutional Source Beutler Lab
Gene Symbol Gabra6
Ensembl Gene ENSMUSG00000020428
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
SynonymsGabra-6, alpha6, GABA-ARalpha6
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3605 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location42306437-42321072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42314950 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 359 (I359F)
Ref Sequence ENSEMBL: ENSMUSP00000104909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020703] [ENSMUST00000109286] [ENSMUST00000155218]
Predicted Effect probably benign
Transcript: ENSMUST00000020703
AA Change: I350F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020703
Gene: ENSMUSG00000020428
AA Change: I350F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 230 2.4e-43 PFAM
Pfam:Neur_chan_memb 237 378 9.3e-43 PFAM
transmembrane domain 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109286
AA Change: I359F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104909
Gene: ENSMUSG00000020428
AA Change: I359F

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 239 2.4e-53 PFAM
Pfam:Neur_chan_memb 246 387 9.7e-43 PFAM
transmembrane domain 422 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155218
AA Change: I360F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126114
Gene: ENSMUSG00000020428
AA Change: I360F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 240 2e-51 PFAM
Pfam:Neur_chan_memb 247 393 6.3e-35 PFAM
transmembrane domain 423 440 N/A INTRINSIC
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal cerebellar cytoarchitecture and normal responses to ethanol, pentobarbital and general anesthetics. Mice homozygous for a reporter allele are behaviorally normal and lack a cochlear phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Gabra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gabra6 APN 11 42317023 missense probably damaging 1.00
IGL01553:Gabra6 APN 11 42315196 missense probably damaging 1.00
IGL01801:Gabra6 APN 11 42315108 missense probably damaging 1.00
IGL02474:Gabra6 APN 11 42307417 missense probably benign
IGL03027:Gabra6 APN 11 42315153 missense probably damaging 1.00
IGL03111:Gabra6 APN 11 42317017 missense probably damaging 1.00
R0121:Gabra6 UTSW 11 42314971 missense probably benign
R0206:Gabra6 UTSW 11 42317079 nonsense probably null
R0240:Gabra6 UTSW 11 42314947 missense probably benign 0.01
R0726:Gabra6 UTSW 11 42315127 missense probably damaging 0.98
R0745:Gabra6 UTSW 11 42316567 missense probably damaging 0.99
R0751:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R0789:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R1666:Gabra6 UTSW 11 42317634 missense probably damaging 1.00
R1754:Gabra6 UTSW 11 42316561 missense probably damaging 1.00
R2317:Gabra6 UTSW 11 42317780 critical splice acceptor site probably null
R4647:Gabra6 UTSW 11 42307372 missense probably damaging 1.00
R5566:Gabra6 UTSW 11 42307490 missense probably benign
R5929:Gabra6 UTSW 11 42317562 missense probably damaging 0.99
R5930:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R5931:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R6155:Gabra6 UTSW 11 42316523 missense probably damaging 1.00
R7249:Gabra6 UTSW 11 42317432 missense probably damaging 1.00
R7759:Gabra6 UTSW 11 42317681 missense probably damaging 1.00
R7783:Gabra6 UTSW 11 42316462 missense probably damaging 1.00
R7794:Gabra6 UTSW 11 42321041 utr 5 prime probably null
R7869:Gabra6 UTSW 11 42316495 missense possibly damaging 0.96
R7952:Gabra6 UTSW 11 42316495 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCTGCCAGGTCAAGTAAAGGTG -3'
(R):5'- ATGCAACCGCCATGGATTG -3'

Sequencing Primer
(F):5'- AATGAAGGCTTTTCCCTAGCTTCAG -3'
(R):5'- CCATGGATTGGTTCATAGCTGTATGC -3'
Posted On2015-02-19