Incidental Mutation 'R3605:Mnt'
ID269060
Institutional Source Beutler Lab
Gene Symbol Mnt
Ensembl Gene ENSMUSG00000000282
Gene Namemax binding protein
SynonymsbHLHd3, Rox
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74830920-74845725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74836920 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 211 (S211T)
Ref Sequence ENSEMBL: ENSMUSP00000000291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000291] [ENSMUST00000132150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000291
AA Change: S211T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000291
Gene: ENSMUSG00000000282
AA Change: S211T

DomainStartEndE-ValueType
coiled coil region 3 53 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
low complexity region 182 205 N/A INTRINSIC
HLH 228 279 2.99e-13 SMART
low complexity region 368 431 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 515 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132150
SMART Domains Protein: ENSMUSP00000118435
Gene: ENSMUSG00000000282

DomainStartEndE-ValueType
HLH 1 47 2.92e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133217
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a targeted null mutation are runted at birth and die within a few days, while mutant fibroblasts show abnormal cell cycling. Those homozygotes that survive are fertile and attain normal Heterozygotes for a conditional mammary epithelial specific knockout develop adenocarcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Mnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mnt APN 11 74842185 missense probably damaging 1.00
R0599:Mnt UTSW 11 74842296 missense probably benign 0.09
R2100:Mnt UTSW 11 74831351 missense probably damaging 1.00
R3076:Mnt UTSW 11 74843110 intron probably benign
R3077:Mnt UTSW 11 74843110 intron probably benign
R3078:Mnt UTSW 11 74843110 intron probably benign
R4601:Mnt UTSW 11 74836459 missense possibly damaging 0.76
R5766:Mnt UTSW 11 74843078 intron probably benign
R6340:Mnt UTSW 11 74836416 missense probably damaging 1.00
R6988:Mnt UTSW 11 74842809 intron probably benign
R7460:Mnt UTSW 11 74843283 missense unknown
Z1176:Mnt UTSW 11 74836675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCGAAGACCACAGTTGC -3'
(R):5'- CGCCATAATCTCCAGTGTTGC -3'

Sequencing Primer
(F):5'- CACAGTTGCGCCCACTG -3'
(R):5'- TGTTGCTGAGGTCCGACAACAG -3'
Posted On2015-02-19