Incidental Mutation 'R3605:Thbs4'
ID269064
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Namethrombospondin 4
SynonymsTSP-4, TSP4
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92751590-92794818 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 92757959 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 685 (C685*)
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
Predicted Effect probably null
Transcript: ENSMUST00000022213
AA Change: C685*
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: C685*

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92776980 missense probably benign 0.04
IGL02318:Thbs4 APN 13 92763584 missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92790798 missense probably benign 0.00
IGL03205:Thbs4 APN 13 92762774 missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92769548 missense probably benign 0.37
R0087:Thbs4 UTSW 13 92755235 missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0130:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0276:Thbs4 UTSW 13 92775532 missense probably benign 0.00
R0423:Thbs4 UTSW 13 92756571 missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92767184 missense probably benign 0.04
R0708:Thbs4 UTSW 13 92773186 missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92758038 missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92762926 splice site probably benign
R1139:Thbs4 UTSW 13 92774718 missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92776905 missense probably benign 0.17
R1342:Thbs4 UTSW 13 92752417 missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92761533 missense probably benign
R1834:Thbs4 UTSW 13 92761481 missense probably benign 0.00
R1950:Thbs4 UTSW 13 92769571 missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92790879 missense probably benign 0.00
R2184:Thbs4 UTSW 13 92774794 missense probably benign
R2198:Thbs4 UTSW 13 92763271 missense possibly damaging 0.78
R2859:Thbs4 UTSW 13 92790708 missense probably benign 0.02
R3783:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3784:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3786:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3787:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R4061:Thbs4 UTSW 13 92776097 critical splice donor site probably null
R4790:Thbs4 UTSW 13 92762806 missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92758068 missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92790699 missense probably benign 0.29
R5185:Thbs4 UTSW 13 92775167 missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92763590 missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92776993 missense probably benign
R5589:Thbs4 UTSW 13 92776074 intron probably null
R5700:Thbs4 UTSW 13 92776953 missense probably benign 0.00
R6061:Thbs4 UTSW 13 92751795 missense probably benign 0.00
R6101:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92774682 missense probably null 1.00
R6249:Thbs4 UTSW 13 92774707 missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92756536 missense probably benign 0.06
R6735:Thbs4 UTSW 13 92755166 missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92762869 missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92757936 missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92773259 nonsense probably null
R7480:Thbs4 UTSW 13 92767221 missense probably benign 0.00
R7682:Thbs4 UTSW 13 92775562 missense probably benign 0.21
R8022:Thbs4 UTSW 13 92752447 missense probably damaging 1.00
Z1177:Thbs4 UTSW 13 92754376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGACTGGGCCATGTTC -3'
(R):5'- AGGCTTCTGTCCCCTACTAAAC -3'

Sequencing Primer
(F):5'- ATGTGATCTCATCCCAGGCCAG -3'
(R):5'- AACTAATCTTTGCTCTGCAGTGACG -3'
Posted On2015-02-19