Mutagenetix > Incidental Mutation

Incidental Mutation 'R3605:Thbs4'

269064

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

040670-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3605 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 92757959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 685 (C685*)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably null
Transcript: ENSMUST00000022213
AA Change: C685*

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: C685*

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.3%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd35	C	T	3: 96,682,181	Q239*	probably null	Het
Arid4b	T	C	13: 14,120,241	V36A	probably damaging	Het
Art2b	T	A	7: 101,579,945	N249I	probably benign	Het
Bpifb1	T	A	2: 154,211,565	N242K	possibly damaging	Het
Cd200r1	A	G	16: 44,789,576	T53A	possibly damaging	Het
Cracr2b	C	T	7: 141,466,146	P370S	possibly damaging	Het
Crb1	T	A	1: 139,237,339	T1016S	probably damaging	Het
Esrrg	A	G	1: 188,211,102	H424R	possibly damaging	Het
Fgfrl1	C	A	5: 108,705,423	T213K	probably damaging	Het
Flrt3	T	A	2: 140,661,367	N114Y	probably damaging	Het
Fsip2	T	C	2: 82,984,909	V3662A	probably benign	Het
Gabra6	T	A	11: 42,314,950	I359F	probably benign	Het
Gal	A	G	19: 3,414,026		probably null	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm5814	G	T	17: 47,410,505	R48L	probably damaging	Het
Hcn1	G	A	13: 117,975,252	G584D	unknown	Het
Iqgap1	T	C	7: 80,723,789	D1484G	probably benign	Het
Kmt2a	G	A	9: 44,849,196	T485M	probably damaging	Het
Kprp	C	A	3: 92,824,281	Q487H	unknown	Het
Lctl	T	C	9: 64,133,193	Y473H	probably damaging	Het
Lrrc8d	G	A	5: 105,827,007	C93Y	unknown	Het
Mnt	T	A	11: 74,836,920	S211T	possibly damaging	Het
Mtdh	T	A	15: 34,114,112		probably benign	Het
Nxt1	T	C	2: 148,675,479	W47R	probably damaging	Het
Olfr1312	T	A	2: 112,042,823	I70F	probably benign	Het
Olfr195	T	C	16: 59,149,483	I211T	probably damaging	Het
Plekha7	T	C	7: 116,164,242	D313G	possibly damaging	Het
Ranbp10	A	G	8: 105,776,035	S300P	probably benign	Het
Rbl1	A	T	2: 157,177,233	F531I	probably damaging	Het
Rpap2	A	G	5: 107,620,529	D411G	probably damaging	Het
Sapcd1	A	G	17: 35,027,805	F36L	probably damaging	Het
Svep1	A	T	4: 58,066,542	S3181T	probably benign	Het
Tgfbr2	G	A	9: 116,109,892	T314I	probably benign	Het
Tk2	A	G	8: 104,231,171	V181A	possibly damaging	Het
Traf2	T	C	2: 25,530,415	T141A	probably benign	Het
Ttn	C	T	2: 76,831,444		probably null	Het
Ube3c	A	G	5: 29,598,938	T180A	possibly damaging	Het
Yif1b	C	T	7: 29,238,410	A7V	possibly damaging	Het
Zfp738	A	T	13: 67,671,389	L151*	probably null	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGACTGGGCCATGTTC -3'
(R):5'- AGGCTTCTGTCCCCTACTAAAC -3'

Sequencing Primer
(F):5'- ATGTGATCTCATCCCAGGCCAG -3'
(R):5'- AACTAATCTTTGCTCTGCAGTGACG -3'

Posted On

2015-02-19