Incidental Mutation 'R3605:Mtdh'
ID269066
Institutional Source Beutler Lab
Gene Symbol Mtdh
Ensembl Gene ENSMUSG00000022255
Gene Namemetadherin
Synonyms3D3/Lyric, 2610103J23Rik, D8Bwg1112e, AEG-1, Lyric
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34082694-34145624 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34114112 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022865] [ENSMUST00000168991] [ENSMUST00000169905]
Predicted Effect probably benign
Transcript: ENSMUST00000022865
SMART Domains Protein: ENSMUSP00000022865
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 6 420 1e-143 PFAM
low complexity region 438 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163333
SMART Domains Protein: ENSMUSP00000130190
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 4 256 2.3e-70 PFAM
Pfam:LYRIC 250 297 4.4e-13 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163697
Predicted Effect probably benign
Transcript: ENSMUST00000168991
SMART Domains Protein: ENSMUSP00000129500
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
low complexity region 111 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169905
SMART Domains Protein: ENSMUSP00000131814
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
low complexity region 121 132 N/A INTRINSIC
low complexity region 232 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170050
SMART Domains Protein: ENSMUSP00000128288
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 3 304 4.2e-90 PFAM
low complexity region 322 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170553
SMART Domains Protein: ENSMUSP00000126167
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 3 106 7.7e-28 PFAM
Pfam:LYRIC 99 220 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226331
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with decreased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Mtdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Mtdh APN 15 34083109 missense probably damaging 1.00
IGL01772:Mtdh APN 15 34139881 missense probably damaging 1.00
IGL02153:Mtdh APN 15 34131250 missense possibly damaging 0.93
IGL02392:Mtdh APN 15 34099577 missense probably damaging 0.98
IGL03052:Mtdh UTSW 15 34140730 missense possibly damaging 0.53
R0062:Mtdh UTSW 15 34134280 splice site probably benign
R0333:Mtdh UTSW 15 34118101 missense possibly damaging 0.86
R0791:Mtdh UTSW 15 34116382 splice site probably benign
R1472:Mtdh UTSW 15 34114045 missense possibly damaging 0.86
R1713:Mtdh UTSW 15 34114839 missense possibly damaging 0.86
R4626:Mtdh UTSW 15 34114834 nonsense probably null
R4957:Mtdh UTSW 15 34083135 missense possibly damaging 0.82
R5196:Mtdh UTSW 15 34118004 missense probably damaging 0.99
R5977:Mtdh UTSW 15 34099574 missense probably damaging 0.99
R6491:Mtdh UTSW 15 34116327 missense probably damaging 1.00
R6852:Mtdh UTSW 15 34136721 missense probably damaging 0.96
R7049:Mtdh UTSW 15 34131165 missense probably damaging 0.97
R7899:Mtdh UTSW 15 34123719 missense possibly damaging 0.92
R7982:Mtdh UTSW 15 34123719 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTCATTGCTACCTTAATACACTGG -3'
(R):5'- TGAATGGCCTCTCAATTGCTCAC -3'

Sequencing Primer
(F):5'- CTGGCTCCTACTTTTTCTAAAA -3'
(R):5'- GCCTCTCAATTGCTCACAATATTGAG -3'
Posted On2015-02-19