Incidental Mutation 'R3605:Cd200r1'
ID269067
Institutional Source Beutler Lab
Gene Symbol Cd200r1
Ensembl Gene ENSMUSG00000022667
Gene NameCD200 receptor 1
SynonymsMox2r, OX2R, CD200R
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44765736-44794978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44789576 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 53 (T53A)
Ref Sequence ENSEMBL: ENSMUSP00000138076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057488] [ENSMUST00000134625] [ENSMUST00000231633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057488
AA Change: T53A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053822
Gene: ENSMUSG00000022667
AA Change: T53A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-47 BLAST
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134625
AA Change: T53A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138076
Gene: ENSMUSG00000022667
AA Change: T53A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231633
Meta Mutation Damage Score 0.2417 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display abnormal sleep patterns including fragmented vigilance states and diminished duration of wakefulness. Mice homozygous for a different knock-out allele exhibit protection from HSV-1 encephalitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Cd200r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Cd200r1 APN 16 44794309 missense possibly damaging 0.88
IGL02111:Cd200r1 APN 16 44788781 missense probably damaging 0.99
IGL02549:Cd200r1 APN 16 44789978 missense probably damaging 1.00
IGL03065:Cd200r1 APN 16 44794282 missense probably benign 0.00
R0218:Cd200r1 UTSW 16 44788743 splice site probably benign
R1512:Cd200r1 UTSW 16 44766027 missense probably benign 0.21
R3877:Cd200r1 UTSW 16 44790011 missense possibly damaging 0.82
R3963:Cd200r1 UTSW 16 44792795 missense probably benign 0.03
R4109:Cd200r1 UTSW 16 44790084 missense possibly damaging 0.95
R4171:Cd200r1 UTSW 16 44792764 missense probably damaging 0.98
R4296:Cd200r1 UTSW 16 44789670 missense probably damaging 0.98
R4396:Cd200r1 UTSW 16 44766054 missense probably benign 0.01
R4922:Cd200r1 UTSW 16 44789676 missense probably damaging 1.00
R5090:Cd200r1 UTSW 16 44789561 missense possibly damaging 0.79
R5302:Cd200r1 UTSW 16 44792809 missense possibly damaging 0.86
R5686:Cd200r1 UTSW 16 44790164 missense probably damaging 1.00
R5838:Cd200r1 UTSW 16 44766034 missense possibly damaging 0.75
R5886:Cd200r1 UTSW 16 44790203 missense possibly damaging 0.75
R5913:Cd200r1 UTSW 16 44789671 missense possibly damaging 0.50
R6529:Cd200r1 UTSW 16 44789702 missense possibly damaging 0.81
R6959:Cd200r1 UTSW 16 44790176 missense probably damaging 0.99
R7185:Cd200r1 UTSW 16 44789612 missense probably benign 0.30
R7211:Cd200r1 UTSW 16 44788757 missense probably benign 0.00
R7386:Cd200r1 UTSW 16 44789848 missense probably benign 0.33
R7773:Cd200r1 UTSW 16 44789687 missense possibly damaging 0.69
RF007:Cd200r1 UTSW 16 44790011 missense possibly damaging 0.82
Z1176:Cd200r1 UTSW 16 44792759 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACATGCCTGAACCTTTACTTTAG -3'
(R):5'- GAAGTTCAGGACTGTGGTCAG -3'

Sequencing Primer
(F):5'- GCCTGAACCTTTACTTTAGAAGATG -3'
(R):5'- TCAGGTGTGGAGGCCCAG -3'
Posted On2015-02-19