Incidental Mutation 'R3606:Ttc30a1'
ID269074
Institutional Source Beutler Lab
Gene Symbol Ttc30a1
Ensembl Gene ENSMUSG00000075271
Gene Nametetratricopeptide repeat domain 30A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location75978247-75981967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75981277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 154 (D154G)
Ref Sequence ENSEMBL: ENSMUSP00000097574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably benign
Transcript: ENSMUST00000099994
AA Change: D154G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271
AA Change: D154G

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099995
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Ttc30a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ttc30a1 APN 2 75981741 unclassified probably benign
IGL01140:Ttc30a1 APN 2 75979915 missense probably benign 0.01
IGL01527:Ttc30a1 APN 2 75980516 missense probably benign
IGL01690:Ttc30a1 APN 2 75979933 missense probably benign
IGL01916:Ttc30a1 APN 2 75980879 missense probably damaging 0.98
IGL02342:Ttc30a1 APN 2 75980632 missense probably benign 0.45
IGL02728:Ttc30a1 APN 2 75980849 missense probably benign 0.01
IGL03171:Ttc30a1 APN 2 75980507 missense probably benign 0.00
PIT4677001:Ttc30a1 UTSW 2 75979769 missense possibly damaging 0.60
R0781:Ttc30a1 UTSW 2 75979976 missense probably damaging 0.98
R1110:Ttc30a1 UTSW 2 75979976 missense probably damaging 0.98
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1750:Ttc30a1 UTSW 2 75980255 missense probably benign 0.21
R2016:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2017:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2020:Ttc30a1 UTSW 2 75980935 missense probably benign
R4272:Ttc30a1 UTSW 2 75980474 missense probably damaging 1.00
R4600:Ttc30a1 UTSW 2 75980633 missense probably benign 0.26
R4894:Ttc30a1 UTSW 2 75979744 makesense probably null
R4996:Ttc30a1 UTSW 2 75979922 missense probably benign
R5217:Ttc30a1 UTSW 2 75980803 missense probably damaging 1.00
R5721:Ttc30a1 UTSW 2 75981371 missense probably damaging 0.99
R6002:Ttc30a1 UTSW 2 75980777 missense possibly damaging 0.59
R6006:Ttc30a1 UTSW 2 75981488 missense probably benign 0.08
R7316:Ttc30a1 UTSW 2 75980857 missense probably damaging 1.00
R7391:Ttc30a1 UTSW 2 75980015 missense probably benign 0.05
R7494:Ttc30a1 UTSW 2 75979898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGAACATCAATGCCCTC -3'
(R):5'- TGTATCCAGAAGCCACCAGG -3'

Sequencing Primer
(F):5'- CGCTCAATGATGTCAGCGATATGC -3'
(R):5'- GGTCACCTTCCTCCTGGACAAC -3'
Posted On2015-02-19