Incidental Mutation 'R3606:Nelfcd'
ID269077
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R3606 (G1)
Quality Score204
Status Not validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174426544 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 525 (Y525C)
Ref Sequence ENSEMBL: ENSMUSP00000016397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably benign
Transcript: ENSMUST00000016397
AA Change: Y525C

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: Y525C

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109075
AA Change: Y509C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: Y509C

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
R7382:Nelfcd UTSW 2 174423383 missense probably benign 0.00
R7532:Nelfcd UTSW 2 174426396 missense probably damaging 1.00
R7545:Nelfcd UTSW 2 174423978 splice site probably null
R7766:Nelfcd UTSW 2 174426832 missense possibly damaging 0.87
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTTGAGACAGAGCACTCCC -3'
(R):5'- ACCGCACTCCATAATAGTCAGG -3'

Sequencing Primer
(F):5'- ACTCCCAGCTAGACGTGATG -3'
(R):5'- GCTTTTCCAGAGACACCGCAG -3'
Posted On2015-02-19