Incidental Mutation 'R3606:Kprp'
ID269078
Institutional Source Beutler Lab
Gene Symbol Kprp
Ensembl Gene ENSMUSG00000059832
Gene Namekeratinocyte expressed, proline-rich
Synonyms1110001M24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92823074-92827247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92824281 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 487 (Q487H)
Ref Sequence ENSEMBL: ENSMUSP00000072200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072363]
Predicted Effect unknown
Transcript: ENSMUST00000072363
AA Change: Q487H
SMART Domains Protein: ENSMUSP00000072200
Gene: ENSMUSG00000059832
AA Change: Q487H

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 446 502 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich skin protein possibly involved in keratinocyte differentiation. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Kprp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Kprp APN 3 92824427 missense unknown
IGL01566:Kprp APN 3 92823964 missense probably benign 0.11
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0244:Kprp UTSW 3 92825411 missense probably benign 0.06
R0364:Kprp UTSW 3 92824335 nonsense probably null
R0414:Kprp UTSW 3 92825713 missense probably damaging 1.00
R0511:Kprp UTSW 3 92824723 missense probably damaging 1.00
R0555:Kprp UTSW 3 92824357 missense unknown
R0800:Kprp UTSW 3 92825035 missense unknown
R1356:Kprp UTSW 3 92825602 missense probably damaging 1.00
R1550:Kprp UTSW 3 92824726 missense probably damaging 0.96
R1571:Kprp UTSW 3 92825382 nonsense probably null
R1618:Kprp UTSW 3 92825476 missense probably damaging 0.99
R2424:Kprp UTSW 3 92825605 missense probably damaging 1.00
R2680:Kprp UTSW 3 92824463 missense unknown
R3605:Kprp UTSW 3 92824281 missense unknown
R3607:Kprp UTSW 3 92824281 missense unknown
R3755:Kprp UTSW 3 92825039 missense unknown
R4116:Kprp UTSW 3 92823968 missense probably damaging 1.00
R4204:Kprp UTSW 3 92824739 missense probably damaging 0.99
R4320:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4321:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4323:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4575:Kprp UTSW 3 92823964 missense probably benign 0.11
R4864:Kprp UTSW 3 92824522 missense unknown
R5133:Kprp UTSW 3 92824522 missense unknown
R5583:Kprp UTSW 3 92824336 missense unknown
R5902:Kprp UTSW 3 92824528 missense unknown
R5990:Kprp UTSW 3 92824774 missense probably damaging 1.00
R6198:Kprp UTSW 3 92824687 missense probably damaging 1.00
R6633:Kprp UTSW 3 92825293 missense probably damaging 1.00
R7025:Kprp UTSW 3 92825197 missense probably benign 0.03
R7269:Kprp UTSW 3 92823871 missense probably damaging 0.96
Z1088:Kprp UTSW 3 92825057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGCTCTGGACTGGAAC -3'
(R):5'- TGTAGGCCACAGCATCTTG -3'

Sequencing Primer
(F):5'- CATTGGCTCTGGATGAGGAAG -3'
(R):5'- TGACCGGTCTCCAGAATCATC -3'
Posted On2015-02-19