Incidental Mutation 'R3606:Ptbp2'
ID269080
Institutional Source Beutler Lab
Gene Symbol Ptbp2
Ensembl Gene ENSMUSG00000028134
Gene Namepolypyrimidine tract binding protein 2
SynonymsbrPTB
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location119718742-119784466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119747632 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 223 (L223P)
Ref Sequence ENSEMBL: ENSMUSP00000143510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029780] [ENSMUST00000197464] [ENSMUST00000197833] [ENSMUST00000200097]
Predicted Effect probably damaging
Transcript: ENSMUST00000029780
AA Change: L223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029780
Gene: ENSMUSG00000028134
AA Change: L223P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 526 1.99e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196343
Predicted Effect probably damaging
Transcript: ENSMUST00000197464
AA Change: L223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143281
Gene: ENSMUSG00000028134
AA Change: L223P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
Pfam:RRM_1 183 239 8.6e-6 PFAM
Pfam:RRM_5 197 240 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197833
AA Change: L223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143719
Gene: ENSMUSG00000028134
AA Change: L223P

DomainStartEndE-ValueType
RRM 60 129 1.7e-8 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 5.2e-7 SMART
low complexity region 285 295 N/A INTRINSIC
PDB:2MJU|A 325 349 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199417
Predicted Effect probably damaging
Transcript: ENSMUST00000200097
AA Change: L223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143510
Gene: ENSMUSG00000028134
AA Change: L223P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 525 8.08e-10 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to intronic polypyrimidine clusters in pre-mRNA molecules and is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein (PTB) but most of its isoforms are expressed primarily in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality with premature neurogenesis and abnormal neural stem cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Ptbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ptbp2 APN 3 119747812 missense probably damaging 1.00
IGL01874:Ptbp2 APN 3 119747800 missense probably damaging 1.00
IGL01940:Ptbp2 APN 3 119726115 missense possibly damaging 0.46
IGL02094:Ptbp2 APN 3 119752940 splice site probably benign
IGL02374:Ptbp2 APN 3 119720693 splice site probably benign
IGL02523:Ptbp2 APN 3 119740487 nonsense probably null
IGL02879:Ptbp2 APN 3 119740405 missense probably damaging 1.00
IGL03149:Ptbp2 APN 3 119720425 missense possibly damaging 0.86
IGL03153:Ptbp2 APN 3 119751944 missense probably benign 0.04
IGL03391:Ptbp2 APN 3 119720382 nonsense probably null
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0091:Ptbp2 UTSW 3 119720661 missense probably damaging 1.00
R0396:Ptbp2 UTSW 3 119724198 splice site probably benign
R0511:Ptbp2 UTSW 3 119720964 missense probably benign
R0722:Ptbp2 UTSW 3 119720921 missense possibly damaging 0.72
R1573:Ptbp2 UTSW 3 119753105 missense probably damaging 1.00
R1907:Ptbp2 UTSW 3 119761749 missense probably damaging 1.00
R5082:Ptbp2 UTSW 3 119752964 missense probably benign 0.06
R5575:Ptbp2 UTSW 3 119720783 splice site probably null
R5575:Ptbp2 UTSW 3 119720789 missense possibly damaging 0.86
R5655:Ptbp2 UTSW 3 119724157 missense probably benign 0.44
R5836:Ptbp2 UTSW 3 119726097 missense probably damaging 0.98
R6290:Ptbp2 UTSW 3 119724120 missense possibly damaging 0.50
R6364:Ptbp2 UTSW 3 119740442 missense probably damaging 1.00
R6398:Ptbp2 UTSW 3 119720835 missense probably benign 0.23
R6574:Ptbp2 UTSW 3 119747947 missense probably damaging 0.99
R7037:Ptbp2 UTSW 3 119751908 missense probably damaging 1.00
R7243:Ptbp2 UTSW 3 119753112 missense possibly damaging 0.47
R7718:Ptbp2 UTSW 3 119720988 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGCGCACTGAACTGTG -3'
(R):5'- TGTCCTTCACCAAGTAAGTGTC -3'

Sequencing Primer
(F):5'- ACTGAACTGTGTGCATGCAC -3'
(R):5'- GTCCTTCACCAAGTAAGTGTCATTTG -3'
Posted On2015-02-19