Incidental Mutation 'R3606:Rundc3b'
ID269081
Institutional Source Beutler Lab
Gene Symbol Rundc3b
Ensembl Gene ENSMUSG00000040570
Gene NameRUN domain containing 3B
SynonymsLOC242819
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8490334-8622952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8512386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 327 (D327E)
Ref Sequence ENSEMBL: ENSMUSP00000111036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047485] [ENSMUST00000115378]
Predicted Effect probably benign
Transcript: ENSMUST00000047485
SMART Domains Protein: ENSMUSP00000040108
Gene: ENSMUSG00000040570

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115378
AA Change: D327E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111036
Gene: ENSMUSG00000040570
AA Change: D327E

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200378
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Rundc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rundc3b APN 5 8569553 missense probably damaging 0.98
IGL01726:Rundc3b APN 5 8520902 missense probably benign 0.24
IGL02271:Rundc3b APN 5 8492530 missense probably damaging 1.00
IGL03394:Rundc3b APN 5 8548261 missense possibly damaging 0.93
F5770:Rundc3b UTSW 5 8622549 small deletion probably benign
R0656:Rundc3b UTSW 5 8569529 missense probably damaging 1.00
R1702:Rundc3b UTSW 5 8512318 missense probably benign
R1776:Rundc3b UTSW 5 8579050 missense probably damaging 1.00
R1829:Rundc3b UTSW 5 8579117 missense probably damaging 1.00
R2011:Rundc3b UTSW 5 8512409 critical splice acceptor site probably null
R4841:Rundc3b UTSW 5 8528742 missense probably damaging 1.00
R6452:Rundc3b UTSW 5 8579175 intron probably null
R6642:Rundc3b UTSW 5 8579071 missense probably damaging 1.00
R7022:Rundc3b UTSW 5 8512348 missense probably null 0.00
R7187:Rundc3b UTSW 5 8492506 missense probably damaging 1.00
R7310:Rundc3b UTSW 5 8521011 nonsense probably null
R7391:Rundc3b UTSW 5 8559455 missense probably benign 0.00
V7582:Rundc3b UTSW 5 8622549 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGATACCAGAGTGGATAGCC -3'
(R):5'- AGATGAAGCAGCAGAGTCCC -3'

Sequencing Primer
(F):5'- TGGATAGCCACATGTTTTGGTACAAC -3'
(R):5'- AGGTTCCTCTGCCATTGA -3'
Posted On2015-02-19