Incidental Mutation 'R3606:Plekha7'
ID269086
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Namepleckstrin homology domain containing, family A member 7
SynonymsA430081P20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location116123485-116308376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116164242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 313 (D313G)
Ref Sequence ENSEMBL: ENSMUSP00000138544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181981] [ENSMUST00000181998] [ENSMUST00000182487] [ENSMUST00000182511] [ENSMUST00000182834] [ENSMUST00000216517]
Predicted Effect probably benign
Transcript: ENSMUST00000084664
AA Change: D139G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659
AA Change: D139G

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181981
AA Change: D270G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138766
Gene: ENSMUSG00000045659
AA Change: D270G

DomainStartEndE-ValueType
PH 59 178 1.42e-18 SMART
low complexity region 231 243 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 453 482 N/A INTRINSIC
coiled coil region 592 631 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 808 824 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181998
AA Change: D375G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659
AA Change: D375G

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182443
AA Change: D293G
Predicted Effect probably benign
Transcript: ENSMUST00000182487
AA Change: D375G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138214
Gene: ENSMUSG00000045659
AA Change: D375G

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182511
AA Change: D313G

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138544
Gene: ENSMUSG00000045659
AA Change: D313G

DomainStartEndE-ValueType
PH 102 221 1.42e-18 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 496 525 N/A INTRINSIC
coiled coil region 635 674 N/A INTRINSIC
coiled coil region 703 736 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
coiled coil region 1002 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182549
Predicted Effect probably benign
Transcript: ENSMUST00000182834
AA Change: D329G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659
AA Change: D329G

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206097
Predicted Effect probably benign
Transcript: ENSMUST00000216517
AA Change: D375G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 116135184 missense probably damaging 1.00
IGL01133:Plekha7 APN 7 116145241 splice site probably null
IGL01146:Plekha7 APN 7 116157473 splice site probably benign
IGL01307:Plekha7 APN 7 116145244 splice site probably benign
IGL02063:Plekha7 APN 7 116140701 missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 116154628 splice site probably null
IGL02420:Plekha7 APN 7 116158234 missense probably damaging 1.00
IGL02660:Plekha7 APN 7 116157574 splice site probably benign
IGL02851:Plekha7 APN 7 116135178 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0130:Plekha7 UTSW 7 116170704 missense probably damaging 0.99
R0348:Plekha7 UTSW 7 116158020 missense probably damaging 1.00
R0595:Plekha7 UTSW 7 116144968 missense probably damaging 1.00
R0614:Plekha7 UTSW 7 116154645 nonsense probably null
R0732:Plekha7 UTSW 7 116145237 missense probably damaging 1.00
R1664:Plekha7 UTSW 7 116135034 splice site probably null
R1695:Plekha7 UTSW 7 116128685 missense probably damaging 1.00
R1794:Plekha7 UTSW 7 116140681 missense probably damaging 1.00
R1895:Plekha7 UTSW 7 116144974 missense probably damaging 1.00
R2153:Plekha7 UTSW 7 116175767 missense probably damaging 1.00
R3106:Plekha7 UTSW 7 116164404 missense probably benign 0.02
R3605:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 116175734 missense probably damaging 1.00
R4584:Plekha7 UTSW 7 116237533 intron probably benign
R4750:Plekha7 UTSW 7 116137311 missense probably damaging 1.00
R4774:Plekha7 UTSW 7 116144943 missense probably damaging 1.00
R4810:Plekha7 UTSW 7 116144938 missense probably damaging 1.00
R4895:Plekha7 UTSW 7 116189391 unclassified probably null
R4925:Plekha7 UTSW 7 116158128 missense probably damaging 1.00
R5556:Plekha7 UTSW 7 116164149 missense probably benign 0.20
R5599:Plekha7 UTSW 7 116176882 splice site probably null
R5848:Plekha7 UTSW 7 116140399 missense probably damaging 1.00
R5928:Plekha7 UTSW 7 116128574 missense probably benign
R5941:Plekha7 UTSW 7 116124805 missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 116176898 missense probably damaging 1.00
R6520:Plekha7 UTSW 7 116164482 missense probably benign 0.16
R6699:Plekha7 UTSW 7 116135175 missense probably damaging 1.00
R6781:Plekha7 UTSW 7 116157855 critical splice donor site probably null
R6843:Plekha7 UTSW 7 116143320 missense probably benign 0.45
R6977:Plekha7 UTSW 7 116135967 missense probably benign 0.01
R7048:Plekha7 UTSW 7 116148324 missense probably benign 0.07
R7269:Plekha7 UTSW 7 116181212 missense probably damaging 1.00
R7480:Plekha7 UTSW 7 116137168 intron probably null
R7520:Plekha7 UTSW 7 116137284 missense possibly damaging 0.95
R7609:Plekha7 UTSW 7 116164446 missense probably benign 0.25
R7680:Plekha7 UTSW 7 116164276 missense probably benign 0.00
R7820:Plekha7 UTSW 7 116237480 missense probably benign 0.12
Z1177:Plekha7 UTSW 7 116140663 missense probably benign 0.01
Z1177:Plekha7 UTSW 7 116307971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGACTAACCTCCTGCCGTC -3'
(R):5'- TGACGCCTGCCAAGAATGTG -3'

Sequencing Primer
(F):5'- TGTCCAGTGCTCTGCCTGG -3'
(R):5'- CCAAGAATGTGGCCACGTG -3'
Posted On2015-02-19