Incidental Mutation 'R3606:Olfr331'
ID269092
Institutional Source Beutler Lab
Gene Symbol Olfr331
Ensembl Gene ENSMUSG00000058807
Gene Nameolfactory receptor 331
SynonymsGA_x6K02T2NKPP-912840-913784, MOR275-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58501598-58502572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58502131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 148 (V148M)
Ref Sequence ENSEMBL: ENSMUSP00000080440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081743] [ENSMUST00000170501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081743
AA Change: V148M

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080440
Gene: ENSMUSG00000058807
AA Change: V148M

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1e-42 PFAM
Pfam:7tm_1 45 299 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170501
AA Change: V142M

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132693
Gene: ENSMUSG00000058807
AA Change: V142M

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:7tm_1 39 292 4.9e-28 PFAM
Pfam:7tm_4 141 285 3.6e-42 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Olfr331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Olfr331 APN 11 58502194 missense possibly damaging 0.89
IGL02458:Olfr331 APN 11 58502247 missense probably benign 0.20
IGL02971:Olfr331 APN 11 58502385 missense probably damaging 1.00
IGL03346:Olfr331 APN 11 58501755 missense possibly damaging 0.76
R0416:Olfr331 UTSW 11 58502396 missense unknown
R1547:Olfr331 UTSW 11 58501825 missense probably damaging 1.00
R1697:Olfr331 UTSW 11 58501676 missense probably damaging 1.00
R1717:Olfr331 UTSW 11 58502059 missense probably benign 0.09
R1721:Olfr331 UTSW 11 58501939 missense probably damaging 1.00
R2194:Olfr331 UTSW 11 58501642 missense probably damaging 0.97
R4457:Olfr331 UTSW 11 58502118 missense probably damaging 1.00
R4766:Olfr331 UTSW 11 58501668 missense probably damaging 1.00
R4858:Olfr331 UTSW 11 58501909 missense probably damaging 1.00
R5475:Olfr331 UTSW 11 58501605 missense probably benign 0.10
R5822:Olfr331 UTSW 11 58501638 missense possibly damaging 0.61
R6337:Olfr331 UTSW 11 58502012 nonsense probably null
R6416:Olfr331 UTSW 11 58502340 missense probably damaging 1.00
R7101:Olfr331 UTSW 11 58502553 missense probably benign 0.00
R7108:Olfr331 UTSW 11 58502554 missense probably benign
RF035:Olfr331 UTSW 11 58502382 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCACAGGGATGAGAAGC -3'
(R):5'- TGCCCAAGATGCTCATGGAC -3'

Sequencing Primer
(F):5'- GCACACATACATGAGGGTCTC -3'
(R):5'- CAAGATGCTCATGGACCAGGTC -3'
Posted On2015-02-19