Incidental Mutation 'R3606:Psmd3'
ID269094
Institutional Source Beutler Lab
Gene Symbol Psmd3
Ensembl Gene ENSMUSG00000017221
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 3
SynonymsPsd3, AntP91a, Tstap91a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98682554-98695979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98690954 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 302 (R302W)
Ref Sequence ENSEMBL: ENSMUSP00000017365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017365]
Predicted Effect probably damaging
Transcript: ENSMUST00000017365
AA Change: R302W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017365
Gene: ENSMUSG00000017221
AA Change: R302W

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
PAM 217 389 1.07e-68 SMART
PINT 389 479 3.26e-27 SMART
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123676
AA Change: R86W
SMART Domains Protein: ENSMUSP00000116968
Gene: ENSMUSG00000017221
AA Change: R86W

DomainStartEndE-ValueType
PAM 2 198 2.1e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152102
Meta Mutation Damage Score 0.3298 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Psmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Psmd3 APN 11 98685568 missense probably benign 0.06
IGL01353:Psmd3 APN 11 98690600 missense probably benign 0.05
R1368:Psmd3 UTSW 11 98682920 missense probably damaging 1.00
R1563:Psmd3 UTSW 11 98694225 missense probably damaging 1.00
R2258:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R2259:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R3607:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R4616:Psmd3 UTSW 11 98682926 missense probably benign 0.00
R4833:Psmd3 UTSW 11 98687760 missense probably damaging 1.00
R5033:Psmd3 UTSW 11 98682824 missense probably damaging 1.00
R5585:Psmd3 UTSW 11 98682881 missense possibly damaging 0.45
R5687:Psmd3 UTSW 11 98693669 missense probably damaging 1.00
R5929:Psmd3 UTSW 11 98695596 missense probably damaging 1.00
R6028:Psmd3 UTSW 11 98685665 missense probably damaging 0.99
R6240:Psmd3 UTSW 11 98693653 missense probably damaging 0.98
R6449:Psmd3 UTSW 11 98685640 missense probably benign
R6956:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7009:Psmd3 UTSW 11 98682766 missense probably benign 0.04
R7051:Psmd3 UTSW 11 98682833 missense possibly damaging 0.68
R7401:Psmd3 UTSW 11 98685640 missense probably benign
R7449:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7549:Psmd3 UTSW 11 98690961 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCCCAGATAGGCACATGAGG -3'
(R):5'- TGGCAACTCCGACACTGATAG -3'

Sequencing Primer
(F):5'- GGCCTGCACATGGGATAATCTAC -3'
(R):5'- TCCGACACTGATAGCCGAG -3'
Posted On2015-02-19