Mutagenetix > Incidental Mutation

Incidental Mutation 'R3606:Ddb1'

269098

Institutional Source

Beutler Lab

Gene Symbol

Ddb1

Ensembl Gene

ENSMUSG00000024740

Gene Name

damage specific DNA binding protein 1

Synonyms

damage-specific DNA-binding protein, DNA repair, p127-Ddb1, DNA repair protein

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3606 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10582961-10607186 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10605857 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1095 (E1095G)

Ref Sequence

ENSEMBL: ENSMUSP00000025649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025649]

AlphaFold

Q3U1J4

Predicted Effect

probably damaging
Transcript: ENSMUST00000025649
AA Change: E1095G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: E1095G

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	75	543	1.9e-122	PFAM
low complexity region	755	775	N/A	INTRINSIC
Pfam:CPSF_A	788	1099	1e-92	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4b	T	C	13: 14,294,826 (GRCm39)	V36A	probably damaging	Het
Cd101	A	T	3: 100,927,913 (GRCm39)	I56N	probably damaging	Het
Cs	A	T	10: 128,195,892 (GRCm39)	H367L	probably benign	Het
Fgfrl1	C	A	5: 108,853,289 (GRCm39)	T213K	probably damaging	Het
Ift70a1	T	C	2: 75,811,621 (GRCm39)	D154G	probably benign	Het
Kprp	C	A	3: 92,731,588 (GRCm39)	Q487H	unknown	Het
Myom2	T	C	8: 15,119,775 (GRCm39)	V177A	probably damaging	Het
Nelfcd	A	G	2: 174,268,337 (GRCm39)	Y525C	probably benign	Het
Or2t49	C	T	11: 58,392,957 (GRCm39)	V148M	possibly damaging	Het
Or5i1	C	A	2: 87,613,551 (GRCm39)	F222L	probably benign	Het
Pcdhgc5	A	G	18: 37,953,560 (GRCm39)	D278G	probably benign	Het
Peg3	T	C	7: 6,711,508 (GRCm39)	E1238G	probably damaging	Het
Plekha7	T	C	7: 115,763,477 (GRCm39)	D313G	possibly damaging	Het
Ppp1r9a	A	G	6: 5,113,674 (GRCm39)	N726S	possibly damaging	Het
Psmd3	C	T	11: 98,581,780 (GRCm39)	R302W	probably damaging	Het
Ptbp2	A	G	3: 119,541,281 (GRCm39)	L223P	probably damaging	Het
Ranbp10	A	G	8: 106,502,667 (GRCm39)	S300P	probably benign	Het
Rundc3b	A	T	5: 8,562,386 (GRCm39)	D327E	probably damaging	Het
Tsr1	T	C	11: 74,796,059 (GRCm39)	S562P	probably benign	Het
Ube3c	A	G	5: 29,803,936 (GRCm39)	T180A	possibly damaging	Het

Other mutations in Ddb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Ddb1	APN	19	10,589,028 (GRCm39)	missense	possibly damaging	0.85
IGL00742:Ddb1	APN	19	10,588,124 (GRCm39)	missense	probably benign
IGL01161:Ddb1	APN	19	10,583,071 (GRCm39)	start codon destroyed	probably null	1.00
IGL01364:Ddb1	APN	19	10,605,024 (GRCm39)	critical splice donor site	probably null
IGL01804:Ddb1	APN	19	10,590,382 (GRCm39)	missense	probably damaging	1.00
IGL01812:Ddb1	APN	19	10,590,382 (GRCm39)	missense	probably damaging	1.00
IGL02523:Ddb1	APN	19	10,604,996 (GRCm39)	missense	probably damaging	1.00
IGL02609:Ddb1	APN	19	10,599,830 (GRCm39)	missense	possibly damaging	0.93
IGL02664:Ddb1	APN	19	10,585,247 (GRCm39)	missense	probably benign
IGL03033:Ddb1	APN	19	10,603,290 (GRCm39)	missense	possibly damaging	0.59
IGL03092:Ddb1	APN	19	10,590,309 (GRCm39)	missense	probably damaging	1.00
IGL03110:Ddb1	APN	19	10,590,309 (GRCm39)	missense	probably damaging	1.00
IGL03256:Ddb1	APN	19	10,599,225 (GRCm39)	missense	probably benign	0.01
Dubitable	UTSW	19	10,599,863 (GRCm39)	critical splice donor site	probably null
Indubitable	UTSW	19	10,585,275 (GRCm39)	critical splice donor site	probably null
Van_der_waals	UTSW	19	10,590,280 (GRCm39)	missense	probably benign	0.11
PIT4445001:Ddb1	UTSW	19	10,603,334 (GRCm39)	missense	probably damaging	1.00
R0028:Ddb1	UTSW	19	10,596,610 (GRCm39)	missense	probably damaging	1.00
R0589:Ddb1	UTSW	19	10,599,080 (GRCm39)	missense	probably benign	0.02
R0893:Ddb1	UTSW	19	10,590,280 (GRCm39)	missense	probably benign	0.11
R1374:Ddb1	UTSW	19	10,585,682 (GRCm39)	missense	probably damaging	1.00
R1611:Ddb1	UTSW	19	10,604,128 (GRCm39)	critical splice donor site	probably null
R1611:Ddb1	UTSW	19	10,590,252 (GRCm39)	missense	probably damaging	1.00
R1661:Ddb1	UTSW	19	10,606,444 (GRCm39)	missense	probably benign	0.00
R1835:Ddb1	UTSW	19	10,603,957 (GRCm39)	missense	probably damaging	1.00
R2036:Ddb1	UTSW	19	10,588,186 (GRCm39)	splice site	probably benign
R2094:Ddb1	UTSW	19	10,590,300 (GRCm39)	missense	probably benign
R2142:Ddb1	UTSW	19	10,596,490 (GRCm39)	critical splice donor site	probably null
R2213:Ddb1	UTSW	19	10,585,691 (GRCm39)	missense	probably damaging	1.00
R2318:Ddb1	UTSW	19	10,603,992 (GRCm39)	missense	probably damaging	1.00
R2354:Ddb1	UTSW	19	10,584,337 (GRCm39)	missense	probably benign	0.03
R3150:Ddb1	UTSW	19	10,590,346 (GRCm39)	missense	probably benign	0.02
R3162:Ddb1	UTSW	19	10,603,335 (GRCm39)	missense	probably damaging	0.99
R3162:Ddb1	UTSW	19	10,603,335 (GRCm39)	missense	probably damaging	0.99
R4050:Ddb1	UTSW	19	10,605,171 (GRCm39)	missense	probably benign	0.00
R5157:Ddb1	UTSW	19	10,599,728 (GRCm39)	missense	probably benign	0.01
R6244:Ddb1	UTSW	19	10,603,287 (GRCm39)	missense	probably damaging	0.99
R6249:Ddb1	UTSW	19	10,583,084 (GRCm39)	nonsense	probably null
R6812:Ddb1	UTSW	19	10,599,863 (GRCm39)	critical splice donor site	probably null
R7337:Ddb1	UTSW	19	10,605,195 (GRCm39)	missense	possibly damaging	0.88
R7460:Ddb1	UTSW	19	10,585,275 (GRCm39)	critical splice donor site	probably null
R7737:Ddb1	UTSW	19	10,603,338 (GRCm39)	missense	possibly damaging	0.93
R7903:Ddb1	UTSW	19	10,585,712 (GRCm39)	missense	probably benign	0.12
R8288:Ddb1	UTSW	19	10,585,712 (GRCm39)	missense	probably benign	0.12
R8376:Ddb1	UTSW	19	10,596,669 (GRCm39)	missense	probably damaging	1.00
R8970:Ddb1	UTSW	19	10,585,808 (GRCm39)	missense	probably benign	0.01
R9720:Ddb1	UTSW	19	10,585,724 (GRCm39)	missense	probably benign
RF016:Ddb1	UTSW	19	10,605,222 (GRCm39)	missense	probably damaging	1.00
X0050:Ddb1	UTSW	19	10,604,023 (GRCm39)	missense	possibly damaging	0.95
Z1088:Ddb1	UTSW	19	10,596,594 (GRCm39)	missense	probably damaging	0.99
Z1177:Ddb1	UTSW	19	10,585,760 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTACCCTAATTGAGAACCATTGG -3'
(R):5'- TGTAGTAAGCATTATGGAAGGCC -3'

Sequencing Primer
(F):5'- CCAAAACTGTCCAAAAGTAGTATGG -3'
(R):5'- GCCACAAAGGGCCACTG -3'

Posted On

2015-02-19