Incidental Mutation 'R3607:Ranbp10'
ID269117
Institutional Source Beutler Lab
Gene Symbol Ranbp10
Ensembl Gene ENSMUSG00000037415
Gene NameRAN binding protein 10
Synonyms
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105768308-105827350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105776035 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 300 (S300P)
Ref Sequence ENSEMBL: ENSMUSP00000040045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041400]
Predicted Effect probably benign
Transcript: ENSMUST00000041400
AA Change: S300P

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040045
Gene: ENSMUSG00000037415
AA Change: S300P

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
SPRY 128 249 5.47e-44 SMART
LisH 281 313 1.63e-2 SMART
CTLH 319 376 4.19e-14 SMART
low complexity region 437 464 N/A INTRINSIC
CRA 534 636 2.04e-22 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAN is a small GTPase involved in the assembly of microtubules to form mitotic spindles. The protein encoded by this gene is a cytoplasmic guanine nucleotide exchange factor (GEF) that binds beta-tubulin and has GEF activity toward RAN. The encoded protein plays a role in the formation of noncentrosomal microtubules. In addition, this protein may be involved in the regulation of D(1) receptor signaling by protein kinase C delta and protein kinase C gamma. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit slight defects in erythrocyte number and volume, decreased platelet aggregattion and increased bleeding time associated with impaired platelet dense granule release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Ranbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Ranbp10 APN 8 105779990 missense probably damaging 1.00
IGL02119:Ranbp10 APN 8 105827003 missense probably damaging 1.00
IGL02120:Ranbp10 APN 8 105805582 missense probably damaging 1.00
R1532:Ranbp10 UTSW 8 105774331 missense probably benign 0.01
R1743:Ranbp10 UTSW 8 105779978 missense probably damaging 1.00
R1970:Ranbp10 UTSW 8 105786708 missense probably damaging 1.00
R3084:Ranbp10 UTSW 8 105774631 missense probably damaging 1.00
R3605:Ranbp10 UTSW 8 105776035 missense probably benign 0.40
R3606:Ranbp10 UTSW 8 105776035 missense probably benign 0.40
R4815:Ranbp10 UTSW 8 105826125 nonsense probably null
R5996:Ranbp10 UTSW 8 105773040 missense probably benign 0.04
R6178:Ranbp10 UTSW 8 105771664 missense possibly damaging 0.82
R6528:Ranbp10 UTSW 8 105779956 missense probably damaging 1.00
R6718:Ranbp10 UTSW 8 105774628 missense possibly damaging 0.62
R7082:Ranbp10 UTSW 8 105773946 missense probably damaging 0.99
R7732:Ranbp10 UTSW 8 105773091 missense probably benign 0.01
R8073:Ranbp10 UTSW 8 105786629 missense probably damaging 1.00
R8103:Ranbp10 UTSW 8 105772547 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGTTGGTCTCCAGGATAGTACAG -3'
(R):5'- TAGCCACTCCTATGACCTGG -3'

Sequencing Primer
(F):5'- TCTCCAGGATAGTACAGATATGGTG -3'
(R):5'- GAGGGAAGTTCTTATTTTCTTTACCC -3'
Posted On2015-02-19