Incidental Mutation 'R3607:Rgl3'
ID269118
Institutional Source Beutler Lab
Gene Symbol Rgl3
Ensembl Gene ENSMUSG00000040146
Gene Nameral guanine nucleotide dissociation stimulator-like 3
Synonyms1300003D20Rik
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21968711-21989446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21987691 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 151 (S151P)
Ref Sequence ENSEMBL: ENSMUSP00000148965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044926] [ENSMUST00000045726] [ENSMUST00000115336] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably benign
Transcript: ENSMUST00000044926
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045726
AA Change: S151P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146
AA Change: S151P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115336
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214026
AA Change: S151P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect unknown
Transcript: ENSMUST00000215851
AA Change: F74S
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Rgl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rgl3 APN 9 21977239 missense probably damaging 1.00
IGL00770:Rgl3 APN 9 21987722 splice site probably benign
IGL00774:Rgl3 APN 9 21987722 splice site probably benign
IGL02071:Rgl3 APN 9 21988263 missense probably benign 0.00
IGL02172:Rgl3 APN 9 21976838 missense probably damaging 1.00
IGL02190:Rgl3 APN 9 21981708 missense probably benign 0.00
IGL02277:Rgl3 APN 9 21974109 missense probably damaging 1.00
IGL02515:Rgl3 APN 9 21974100 missense possibly damaging 0.93
R0077:Rgl3 UTSW 9 21974102 missense probably benign 0.00
R0126:Rgl3 UTSW 9 21975812 missense probably benign 0.06
R0360:Rgl3 UTSW 9 21976857 missense probably damaging 0.97
R0421:Rgl3 UTSW 9 21976032 missense probably benign 0.06
R0556:Rgl3 UTSW 9 21975844 nonsense probably null
R0751:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1184:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1548:Rgl3 UTSW 9 21980706 missense probably benign 0.11
R2176:Rgl3 UTSW 9 21975958 utr 3 prime probably benign
R3154:Rgl3 UTSW 9 21980774 missense probably damaging 1.00
R3803:Rgl3 UTSW 9 21976025 missense probably damaging 1.00
R3958:Rgl3 UTSW 9 21975589 intron probably benign
R4081:Rgl3 UTSW 9 21987675 missense possibly damaging 0.79
R4937:Rgl3 UTSW 9 21987708 nonsense probably null
R5068:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5070:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5217:Rgl3 UTSW 9 21987648 makesense probably null
R5772:Rgl3 UTSW 9 21981612 missense probably benign 0.00
R5819:Rgl3 UTSW 9 21981602 critical splice donor site probably null
R6509:Rgl3 UTSW 9 21971908 missense probably benign 0.00
R7425:Rgl3 UTSW 9 21976827 nonsense probably null
R7744:Rgl3 UTSW 9 21987570 missense probably benign 0.00
X0019:Rgl3 UTSW 9 21981479 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGTGGTATTCTCTCAGAATG -3'
(R):5'- TCAGCAAGAACCTGAGGTCG -3'

Sequencing Primer
(F):5'- CAGAATGTCACCTGAATTGACTGTCC -3'
(R):5'- AAGAACCTGAGGTCGGTTTCC -3'
Posted On2015-02-19