Mutagenetix > Incidental Mutations

Incidental Mutation 'R3607:Lctl'

269121

Institutional Source

Beutler Lab

Gene Symbol

Lctl

Ensembl Gene

ENSMUSG00000032401

Gene Name

lactase-like

Synonyms

E130104I05Rik, KLPH

MMRRC Submission

040671-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R3607 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64117147-64138118 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64133193 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 473 (Y473H)

Ref Sequence

ENSEMBL: ENSMUSP00000034969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000122091] [ENSMUST00000124020] [ENSMUST00000176299]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034969
AA Change: Y473H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: Y473H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Glyco_hydro_1	32	502	1.7e-161	PFAM
transmembrane domain	540	562	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118215
AA Change: Y314H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401
AA Change: Y314H

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	1	343	5.8e-99	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122091

SMART Domains

Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	38	589	6e-206	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124020

SMART Domains

Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Glyco_hydro_1	32	235	2.3e-84	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176299

SMART Domains

Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	1	471	2.9e-192	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176848

Meta Mutation Damage Score

0.1562

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 93.3%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930510E17Rik	C	A	9: 53,279,783		noncoding transcript	Het
Adnp2	A	T	18: 80,129,069	N708K	probably damaging	Het
Arhgef17	C	A	7: 100,931,172	G190W	probably damaging	Het
Aspm	T	A	1: 139,480,668	M2431K	probably benign	Het
Aurkc	A	G	7: 7,002,860	Y157C	probably damaging	Het
Bpifb1	T	A	2: 154,211,565	N242K	possibly damaging	Het
Cracr2b	C	T	7: 141,466,146	P370S	possibly damaging	Het
Etv1	A	G	12: 38,831,086	Y66C	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,708	K288*	probably null	Het
Fam131a	C	T	16: 20,701,595	P181L	probably damaging	Het
Fat2	T	A	11: 55,281,685	E2734V	probably damaging	Het
Fgfrl1	C	A	5: 108,705,423	T213K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gmfg	T	A	7: 28,441,536		probably null	Het
Gtpbp8	T	C	16: 44,743,756	Y184C	probably damaging	Het
Heatr5b	T	C	17: 78,834,217	E2G	probably damaging	Het
Itpr2	T	G	6: 146,227,601	T2005P	probably damaging	Het
Kmt2a	G	A	9: 44,849,196	T485M	probably damaging	Het
Kng1	T	C	16: 23,067,802	F112L	probably damaging	Het
Kprp	C	A	3: 92,824,281	Q487H	unknown	Het
Lpin2	T	A	17: 71,229,392	D225E	probably damaging	Het
Myom2	T	C	8: 15,069,775	V177A	probably damaging	Het
Nkrf	T	G	X: 36,890,077	N184T	probably benign	Het
Nt5c1b	A	G	12: 10,377,236	N329D	probably damaging	Het
Ogdhl	T	A	14: 32,335,361	V308E	probably damaging	Het
Olfr304	A	G	7: 86,385,695	C322R	probably benign	Het
Pcnx	T	A	12: 81,928,292	F791I	probably damaging	Het
Prkg2	G	T	5: 98,947,377	T616K	probably damaging	Het
Psmd3	C	T	11: 98,690,954	R302W	probably damaging	Het
Ptpn1	A	G	2: 167,975,507	S355G	probably benign	Het
Pxdn	A	G	12: 29,990,918	N398D	probably benign	Het
Ranbp10	A	G	8: 105,776,035	S300P	probably benign	Het
Rbl1	A	T	2: 157,177,233	F531I	probably damaging	Het
Rgl3	A	G	9: 21,987,691	S151P	probably damaging	Het
Rnf213	C	A	11: 119,441,976	C2670*	probably null	Het
Tex16	T	A	X: 112,093,970	S159T	probably damaging	Het
Tnfaip3	A	G	10: 19,005,602	I312T	probably damaging	Het
Traf2	T	C	2: 25,530,415	T141A	probably benign	Het
Trpm7	T	C	2: 126,796,428		probably benign	Het
Usp11	T	G	X: 20,714,632	F426L	probably damaging	Het
Vcan	G	T	13: 89,703,301	T1180K	probably damaging	Het
Wasf1	G	C	10: 40,936,384	A390P	unknown	Het
Yif1b	C	T	7: 29,238,410	A7V	possibly damaging	Het

Other mutations in Lctl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Lctl	APN	9	64133129	nonsense	probably null
IGL03066:Lctl	APN	9	64117735	start codon destroyed	probably null	0.66
IGL03302:Lctl	APN	9	64134848	unclassified	probably benign
R0077:Lctl	UTSW	9	64122107	start codon destroyed	probably null	0.64
R0137:Lctl	UTSW	9	64117698	utr 5 prime	probably benign
R0335:Lctl	UTSW	9	64118887	missense	probably benign	0.00
R0391:Lctl	UTSW	9	64122314	splice site	probably benign
R1740:Lctl	UTSW	9	64133107	missense	probably damaging	1.00
R1866:Lctl	UTSW	9	64131721	missense	probably damaging	1.00
R2160:Lctl	UTSW	9	64117767	missense	probably benign	0.02
R2867:Lctl	UTSW	9	64137868	missense	probably benign	0.23
R2867:Lctl	UTSW	9	64137868	missense	probably benign	0.23
R3605:Lctl	UTSW	9	64133193	missense	probably damaging	1.00
R4585:Lctl	UTSW	9	64131600	missense	probably damaging	1.00
R4861:Lctl	UTSW	9	64119763	missense	possibly damaging	0.55
R4861:Lctl	UTSW	9	64119763	missense	possibly damaging	0.55
R5249:Lctl	UTSW	9	64137914	missense	probably benign
R7021:Lctl	UTSW	9	64132793	splice site	probably null
R7106:Lctl	UTSW	9	64132837	missense	probably benign	0.22
R7221:Lctl	UTSW	9	64118935	nonsense	probably null
R7265:Lctl	UTSW	9	64126921	missense	probably damaging	1.00
R7353:Lctl	UTSW	9	64126967	missense	probably damaging	1.00
R7501:Lctl	UTSW	9	64131579	missense	probably benign	0.00
R7615:Lctl	UTSW	9	64122110	missense	probably damaging	1.00
R7855:Lctl	UTSW	9	64133216	missense	possibly damaging	0.89
RF014:Lctl	UTSW	9	64118930	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCACTCAGTTCTGCGATG -3'
(R):5'- CCCCTCCTTTGAAAGAAAGAAGTG -3'

Sequencing Primer
(F):5'- TCTGCGATGAGTGGAGAATCC -3'
(R):5'- CCTTTGAAAGAAAGAAGTGTGGTTC -3'

Posted On

2015-02-19