Incidental Mutation 'R3607:Lctl'
ID269121
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Namelactase-like
SynonymsE130104I05Rik, KLPH
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64117147-64138118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64133193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 473 (Y473H)
Ref Sequence ENSEMBL: ENSMUSP00000034969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000122091] [ENSMUST00000124020] [ENSMUST00000176299]
Predicted Effect probably damaging
Transcript: ENSMUST00000034969
AA Change: Y473H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: Y473H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118215
AA Change: Y314H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401
AA Change: Y314H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124020
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176848
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64133129 nonsense probably null
IGL03066:Lctl APN 9 64117735 start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64134848 unclassified probably benign
R0077:Lctl UTSW 9 64122107 start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64117698 utr 5 prime probably benign
R0335:Lctl UTSW 9 64118887 missense probably benign 0.00
R0391:Lctl UTSW 9 64122314 splice site probably benign
R1740:Lctl UTSW 9 64133107 missense probably damaging 1.00
R1866:Lctl UTSW 9 64131721 missense probably damaging 1.00
R2160:Lctl UTSW 9 64117767 missense probably benign 0.02
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R3605:Lctl UTSW 9 64133193 missense probably damaging 1.00
R4585:Lctl UTSW 9 64131600 missense probably damaging 1.00
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R5249:Lctl UTSW 9 64137914 missense probably benign
R7021:Lctl UTSW 9 64132793 splice site probably null
R7106:Lctl UTSW 9 64132837 missense probably benign 0.22
R7221:Lctl UTSW 9 64118935 nonsense probably null
R7265:Lctl UTSW 9 64126921 missense probably damaging 1.00
R7353:Lctl UTSW 9 64126967 missense probably damaging 1.00
R7501:Lctl UTSW 9 64131579 missense probably benign 0.00
R7615:Lctl UTSW 9 64122110 missense probably damaging 1.00
RF014:Lctl UTSW 9 64118930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCACTCAGTTCTGCGATG -3'
(R):5'- CCCCTCCTTTGAAAGAAAGAAGTG -3'

Sequencing Primer
(F):5'- TCTGCGATGAGTGGAGAATCC -3'
(R):5'- CCTTTGAAAGAAAGAAGTGTGGTTC -3'
Posted On2015-02-19