Mutagenetix > Incidental Mutations

Incidental Mutation 'R3607:Pxdn'

269131

Institutional Source

Beutler Lab

Gene Symbol

Pxdn

Ensembl Gene

ENSMUSG00000020674

Gene Name

peroxidasin

Synonyms

VPO1, 2310075M15Rik

MMRRC Submission

040671-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R3607 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29937608-30017658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29990918 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 398 (N398D)

Ref Sequence

ENSEMBL: ENSMUSP00000113703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118321] [ENSMUST00000122328] [ENSMUST00000220271]

Predicted Effect

probably benign
Transcript: ENSMUST00000118321

SMART Domains

Protein: ENSMUSP00000113477
Gene: ENSMUSG00000020674

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LRRNT	32	63	2.52e-1	SMART
LRR	62	81	4.09e1	SMART
LRR_TYP	82	105	3.69e-4	SMART
LRR_TYP	106	129	1.45e-2	SMART
LRR_TYP	130	153	8.02e-5	SMART
LRR_TYP	154	177	1.06e-4	SMART
LRRCT	189	241	3.97e-5	SMART
IGc2	255	321	1.59e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122328
AA Change: N398D

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: N398D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LRRNT	32	63	2.52e-1	SMART
LRR	62	81	4.09e1	SMART
LRR_TYP	82	105	3.69e-4	SMART
LRR_TYP	106	129	1.45e-2	SMART
LRR_TYP	130	153	8.02e-5	SMART
LRR_TYP	154	177	1.06e-4	SMART
LRRCT	189	241	3.97e-5	SMART
IGc2	255	321	1.59e-15	SMART
IGc2	351	416	3.96e-16	SMART
IGc2	442	506	2.96e-15	SMART
IGc2	534	598	1.2e-15	SMART
Pfam:An_peroxidase	738	1286	1.1e-196	PFAM
VWC	1411	1466	8.8e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155318

Predicted Effect

probably benign
Transcript: ENSMUST00000220271
AA Change: N218D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.2689

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 93.3%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930510E17Rik	C	A	9: 53,279,783		noncoding transcript	Het
Adnp2	A	T	18: 80,129,069	N708K	probably damaging	Het
Arhgef17	C	A	7: 100,931,172	G190W	probably damaging	Het
Aspm	T	A	1: 139,480,668	M2431K	probably benign	Het
Aurkc	A	G	7: 7,002,860	Y157C	probably damaging	Het
Bpifb1	T	A	2: 154,211,565	N242K	possibly damaging	Het
Cracr2b	C	T	7: 141,466,146	P370S	possibly damaging	Het
Etv1	A	G	12: 38,831,086	Y66C	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,708	K288*	probably null	Het
Fam131a	C	T	16: 20,701,595	P181L	probably damaging	Het
Fat2	T	A	11: 55,281,685	E2734V	probably damaging	Het
Fgfrl1	C	A	5: 108,705,423	T213K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gmfg	T	A	7: 28,441,536		probably null	Het
Gtpbp8	T	C	16: 44,743,756	Y184C	probably damaging	Het
Heatr5b	T	C	17: 78,834,217	E2G	probably damaging	Het
Itpr2	T	G	6: 146,227,601	T2005P	probably damaging	Het
Kmt2a	G	A	9: 44,849,196	T485M	probably damaging	Het
Kng1	T	C	16: 23,067,802	F112L	probably damaging	Het
Kprp	C	A	3: 92,824,281	Q487H	unknown	Het
Lctl	T	C	9: 64,133,193	Y473H	probably damaging	Het
Lpin2	T	A	17: 71,229,392	D225E	probably damaging	Het
Myom2	T	C	8: 15,069,775	V177A	probably damaging	Het
Nkrf	T	G	X: 36,890,077	N184T	probably benign	Het
Nt5c1b	A	G	12: 10,377,236	N329D	probably damaging	Het
Ogdhl	T	A	14: 32,335,361	V308E	probably damaging	Het
Olfr304	A	G	7: 86,385,695	C322R	probably benign	Het
Pcnx	T	A	12: 81,928,292	F791I	probably damaging	Het
Prkg2	G	T	5: 98,947,377	T616K	probably damaging	Het
Psmd3	C	T	11: 98,690,954	R302W	probably damaging	Het
Ptpn1	A	G	2: 167,975,507	S355G	probably benign	Het
Ranbp10	A	G	8: 105,776,035	S300P	probably benign	Het
Rbl1	A	T	2: 157,177,233	F531I	probably damaging	Het
Rgl3	A	G	9: 21,987,691	S151P	probably damaging	Het
Rnf213	C	A	11: 119,441,976	C2670*	probably null	Het
Tex16	T	A	X: 112,093,970	S159T	probably damaging	Het
Tnfaip3	A	G	10: 19,005,602	I312T	probably damaging	Het
Traf2	T	C	2: 25,530,415	T141A	probably benign	Het
Trpm7	T	C	2: 126,796,428		probably benign	Het
Usp11	T	G	X: 20,714,632	F426L	probably damaging	Het
Vcan	G	T	13: 89,703,301	T1180K	probably damaging	Het
Wasf1	G	C	10: 40,936,384	A390P	unknown	Het
Yif1b	C	T	7: 29,238,410	A7V	possibly damaging	Het

Other mutations in Pxdn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Pxdn	APN	12	29987099	missense	probably damaging	1.00
IGL01152:Pxdn	APN	12	30001937	missense	probably damaging	0.99
IGL01286:Pxdn	APN	12	29982754	missense	probably benign	0.04
IGL01323:Pxdn	APN	12	29987137	missense	probably benign	0.00
IGL01338:Pxdn	APN	12	30002797	missense	probably damaging	1.00
IGL01341:Pxdn	APN	12	30002487	missense	probably damaging	1.00
IGL01401:Pxdn	APN	12	30001984	missense	probably damaging	1.00
IGL01580:Pxdn	APN	12	29984493	missense	probably benign	0.18
IGL01650:Pxdn	APN	12	30002401	missense	probably benign	0.01
IGL01679:Pxdn	APN	12	29999902	missense	probably damaging	0.97
IGL01866:Pxdn	APN	12	29984571	missense	probably benign	0.02
IGL02354:Pxdn	APN	12	29999189	missense	probably damaging	1.00
IGL02361:Pxdn	APN	12	29999189	missense	probably damaging	1.00
IGL02427:Pxdn	APN	12	29984532	missense	probably damaging	1.00
IGL02955:Pxdn	APN	12	30003157	missense	probably damaging	1.00
IGL03079:Pxdn	APN	12	30002998	missense	probably damaging	0.97
IGL03111:Pxdn	APN	12	29982756	missense	probably damaging	0.99
IGL02988:Pxdn	UTSW	12	30003114	nonsense	probably null
PIT4280001:Pxdn	UTSW	12	29995328	missense	probably damaging	0.99
PIT4469001:Pxdn	UTSW	12	30005829	missense	probably benign	0.00
R0070:Pxdn	UTSW	12	29982727	missense	probably damaging	0.99
R0070:Pxdn	UTSW	12	29982727	missense	probably damaging	0.99
R0086:Pxdn	UTSW	12	30002419	missense	possibly damaging	0.95
R0140:Pxdn	UTSW	12	29982754	missense	probably benign	0.04
R0201:Pxdn	UTSW	12	30002431	missense	possibly damaging	0.79
R0282:Pxdn	UTSW	12	29984440	nonsense	probably null
R0310:Pxdn	UTSW	12	30015529	missense	probably damaging	1.00
R0426:Pxdn	UTSW	12	29987066	missense	possibly damaging	0.89
R0468:Pxdn	UTSW	12	29994486	missense	probably damaging	0.99
R0825:Pxdn	UTSW	12	29984996	splice site	probably benign
R0885:Pxdn	UTSW	12	30003402	missense	probably benign	0.30
R1420:Pxdn	UTSW	12	30002068	missense	probably damaging	1.00
R1588:Pxdn	UTSW	12	30002559	missense	probably damaging	1.00
R2269:Pxdn	UTSW	12	30005775	missense	probably damaging	0.97
R2280:Pxdn	UTSW	12	29984906	missense	probably damaging	0.98
R2504:Pxdn	UTSW	12	30003406	missense	probably damaging	1.00
R2679:Pxdn	UTSW	12	29975569	splice site	probably benign
R3116:Pxdn	UTSW	12	30002307	missense	possibly damaging	0.89
R4033:Pxdn	UTSW	12	30003225	missense	probably benign	0.19
R4576:Pxdn	UTSW	12	30011923	missense	probably benign
R4659:Pxdn	UTSW	12	29994553	missense	probably benign	0.01
R4681:Pxdn	UTSW	12	30012326	missense	probably benign	0.45
R4968:Pxdn	UTSW	12	30000012	missense	probably benign	0.25
R5032:Pxdn	UTSW	12	30003141	missense	probably benign	0.08
R5232:Pxdn	UTSW	12	29990988	missense	probably benign	0.08
R5366:Pxdn	UTSW	12	30002900	missense	probably damaging	1.00
R5504:Pxdn	UTSW	12	30002801	missense	probably damaging	1.00
R5586:Pxdn	UTSW	12	30003142	missense	probably damaging	0.99
R5739:Pxdn	UTSW	12	29982334	missense	probably benign	0.03
R5877:Pxdn	UTSW	12	30003046	missense	probably damaging	1.00
R6167:Pxdn	UTSW	12	29974001	missense	probably damaging	1.00
R6191:Pxdn	UTSW	12	29982717	missense	possibly damaging	0.94
R6200:Pxdn	UTSW	12	30003112	missense	probably damaging	1.00
R6609:Pxdn	UTSW	12	30002941	missense	probably benign	0.00
R6628:Pxdn	UTSW	12	29999918	missense	probably damaging	1.00
R6865:Pxdn	UTSW	12	30014583	splice site	probably null
R6921:Pxdn	UTSW	12	30015505	missense	probably damaging	0.96
R6995:Pxdn	UTSW	12	29995371	missense	possibly damaging	0.95
R7211:Pxdn	UTSW	12	29984904	missense	possibly damaging	0.77
R7220:Pxdn	UTSW	12	29994480	missense	probably benign	0.02
R7347:Pxdn	UTSW	12	30012261	missense	probably benign	0.01
R7402:Pxdn	UTSW	12	30002439	missense	probably damaging	1.00
R7408:Pxdn	UTSW	12	29990945	missense	probably benign	0.29
R7413:Pxdn	UTSW	12	30002928	missense	probably benign	0.00
R7447:Pxdn	UTSW	12	29984927	missense	probably damaging	1.00
R7572:Pxdn	UTSW	12	30006705	missense	probably damaging	1.00
R7708:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R7815:Pxdn	UTSW	12	30005825	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AATGAGCAGCCTGGACATC -3'
(R):5'- TAGTATAGGCGGGGCACAGC -3'

Sequencing Primer
(F):5'- TGTTTGTGACAGCCCGAC -3'
(R):5'- CCAAGAAGGCTGTTGGAGCTATG -3'

Posted On

2015-02-19