Incidental Mutation 'R3607:Ogdhl'
ID269135
Institutional Source Beutler Lab
Gene Symbol Ogdhl
Ensembl Gene ENSMUSG00000021913
Gene Nameoxoglutarate dehydrogenase-like
Synonyms
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32322019-32348151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32335361 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 308 (V308E)
Ref Sequence ENSEMBL: ENSMUSP00000154185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022480] [ENSMUST00000228529]
Predicted Effect probably damaging
Transcript: ENSMUST00000022480
AA Change: V327E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022480
Gene: ENSMUSG00000021913
AA Change: V327E

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 44 81 2.7e-18 PFAM
Blast:Transket_pyr 118 154 8e-14 BLAST
Pfam:E1_dh 262 588 1.8e-88 PFAM
Transket_pyr 657 870 2.64e-51 SMART
Pfam:OxoGdeHyase_C 874 1019 8.3e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228529
AA Change: V308E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9455 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to oxoglutarate dehydrogenase (OGDH) of the OGDH complex, which degrades glucose and glutamate. This gene encodes several isoforms, including some that appear to localize to mitochondria. The encoded protein down-regulates the AKT signaling cascade and can suppress the growth of cervical cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Ogdhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ogdhl APN 14 32333712 missense probably damaging 1.00
IGL00425:Ogdhl APN 14 32346490 missense probably damaging 1.00
IGL01509:Ogdhl APN 14 32337759 missense probably damaging 1.00
IGL01704:Ogdhl APN 14 32337631 splice site probably benign
IGL01760:Ogdhl APN 14 32339937 missense probably damaging 1.00
IGL02376:Ogdhl APN 14 32343318 missense probably damaging 1.00
IGL02508:Ogdhl APN 14 32345174 missense probably damaging 0.99
IGL02834:Ogdhl APN 14 32325946 missense probably damaging 1.00
IGL03100:Ogdhl APN 14 32342072 missense probably benign 0.03
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0207:Ogdhl UTSW 14 32342037 splice site probably null
R0322:Ogdhl UTSW 14 32337577 missense probably benign 0.09
R0357:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R0417:Ogdhl UTSW 14 32326979 missense probably damaging 1.00
R0677:Ogdhl UTSW 14 32339925 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1541:Ogdhl UTSW 14 32340667 missense possibly damaging 0.80
R1589:Ogdhl UTSW 14 32325865 missense probably benign
R1831:Ogdhl UTSW 14 32337527 missense probably damaging 0.99
R2059:Ogdhl UTSW 14 32332884 missense probably damaging 1.00
R2133:Ogdhl UTSW 14 32325934 missense probably benign
R2179:Ogdhl UTSW 14 32335345 missense probably damaging 0.99
R2656:Ogdhl UTSW 14 32332826 missense possibly damaging 0.89
R4617:Ogdhl UTSW 14 32325885 missense probably benign
R4668:Ogdhl UTSW 14 32332536 missense probably benign 0.00
R5419:Ogdhl UTSW 14 32339224 missense probably damaging 1.00
R5575:Ogdhl UTSW 14 32325847 missense possibly damaging 0.60
R5793:Ogdhl UTSW 14 32332773 missense probably damaging 0.96
R5812:Ogdhl UTSW 14 32332865 missense probably damaging 1.00
R5990:Ogdhl UTSW 14 32327114 missense possibly damaging 0.77
R6224:Ogdhl UTSW 14 32342061 missense probably benign 0.09
R7834:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7837:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R8166:Ogdhl UTSW 14 32337806 missense probably damaging 1.00
Z1177:Ogdhl UTSW 14 32343280 missense probably damaging 1.00
Z1177:Ogdhl UTSW 14 32346411 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTGGTATATCAAGGCAGGATGG -3'
(R):5'- CTACTTACCAAGCCTGAGGGAC -3'

Sequencing Primer
(F):5'- ATGGGAGGATTGGGCCTTAC -3'
(R):5'- TGATGCAAGCAGCCCAGTC -3'
Posted On2015-02-19