Incidental Mutation 'R3607:Kng1'
ID269137
Institutional Source Beutler Lab
Gene Symbol Kng1
Ensembl Gene ENSMUSG00000022875
Gene Namekininogen 1
SynonymsH-kininigen, L-kininogen
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23057865-23082078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23067802 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 112 (F112L)
Ref Sequence ENSEMBL: ENSMUSP00000121701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023589] [ENSMUST00000039492] [ENSMUST00000089902] [ENSMUST00000125790]
Predicted Effect probably damaging
Transcript: ENSMUST00000023589
AA Change: F166L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875
AA Change: F166L

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039492
AA Change: F166L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875
AA Change: F166L

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089902
AA Change: F166L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875
AA Change: F166L

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125790
AA Change: F112L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121701
Gene: ENSMUSG00000022875
AA Change: F112L

DomainStartEndE-ValueType
Pfam:Cystatin 1 62 6.5e-11 PFAM
Pfam:Cystatin 89 134 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136778
Meta Mutation Damage Score 0.4926 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and grossly unaffected with normal tail vein bleeding times, despite loss of detectable plasma kininogen. However, homozygotes show a significantly longer time to carotid artery occlusion after RoseBengal and laser-induced arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Kng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Kng1 APN 16 23079194 missense probably benign 0.26
IGL01754:Kng1 APN 16 23079614 missense probably benign 0.10
IGL02049:Kng1 APN 16 23073437 missense probably damaging 0.99
IGL02138:Kng1 APN 16 23067808 missense probably damaging 0.99
IGL02216:Kng1 APN 16 23058533 missense probably damaging 0.98
IGL02230:Kng1 APN 16 23060494 critical splice donor site probably null
IGL02630:Kng1 APN 16 23079845 utr 3 prime probably benign
IGL03024:Kng1 APN 16 23074692 missense possibly damaging 0.92
R0518:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R0521:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R1352:Kng1 UTSW 16 23067694 critical splice acceptor site probably null
R1396:Kng1 UTSW 16 23078980 missense probably benign 0.00
R1514:Kng1 UTSW 16 23079760 missense probably damaging 0.97
R1753:Kng1 UTSW 16 23079119 missense possibly damaging 0.68
R2048:Kng1 UTSW 16 23058604 missense probably damaging 0.98
R2290:Kng1 UTSW 16 23079125 missense possibly damaging 0.79
R2357:Kng1 UTSW 16 23079065 missense possibly damaging 0.88
R3014:Kng1 UTSW 16 23079370 missense possibly damaging 0.72
R4322:Kng1 UTSW 16 23079520 missense probably benign
R4334:Kng1 UTSW 16 23079620 missense possibly damaging 0.88
R4388:Kng1 UTSW 16 23079318 missense possibly damaging 0.63
R4558:Kng1 UTSW 16 23077418 splice site probably null
R4887:Kng1 UTSW 16 23067698 missense possibly damaging 0.71
R5115:Kng1 UTSW 16 23069282 missense possibly damaging 0.87
R5288:Kng1 UTSW 16 23079092 missense probably damaging 0.96
R5461:Kng1 UTSW 16 23079137 missense probably benign 0.19
R5894:Kng1 UTSW 16 23073363 missense probably benign 0.08
R6137:Kng1 UTSW 16 23074645 missense possibly damaging 0.56
R6260:Kng1 UTSW 16 23058621 missense possibly damaging 0.66
R6291:Kng1 UTSW 16 23079725 missense probably damaging 1.00
R6620:Kng1 UTSW 16 23081482 missense possibly damaging 0.74
R6947:Kng1 UTSW 16 23077374 missense probably benign 0.21
R7142:Kng1 UTSW 16 23079420 missense probably benign 0.25
R7166:Kng1 UTSW 16 23079678 missense probably benign 0.00
R7168:Kng1 UTSW 16 23079641 missense probably benign 0.26
R7347:Kng1 UTSW 16 23067787 missense possibly damaging 0.46
Z1176:Kng1 UTSW 16 23079616 missense probably benign 0.00
Z1177:Kng1 UTSW 16 23073389 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCAGGATCTTTCTAAATGGTCTCAG -3'
(R):5'- AAACACGGGCACTCTAGGAC -3'

Sequencing Primer
(F):5'- CTAAATGGTCTCAGGGGTTTAGGAC -3'
(R):5'- ACTCTAGGACGATGCCAGCATG -3'
Posted On2015-02-19