Incidental Mutation 'R3607:Gtpbp8'
ID269138
Institutional Source Beutler Lab
Gene Symbol Gtpbp8
Ensembl Gene ENSMUSG00000022668
Gene NameGTP-binding protein 8 (putative)
Synonyms
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44736768-44746363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44743756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 184 (Y184C)
Ref Sequence ENSEMBL: ENSMUSP00000125352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023348] [ENSMUST00000161436] [ENSMUST00000162512]
Predicted Effect probably damaging
Transcript: ENSMUST00000023348
AA Change: Y117C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023348
Gene: ENSMUSG00000022668
AA Change: Y117C

DomainStartEndE-ValueType
Pfam:SRPRB 42 164 4.1e-7 PFAM
Pfam:GTP_EFTU 42 214 3.4e-9 PFAM
Pfam:FeoB_N 45 208 5.9e-6 PFAM
Pfam:MMR_HSR1 46 161 5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161436
AA Change: Y133C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123974
Gene: ENSMUSG00000022668
AA Change: Y133C

DomainStartEndE-ValueType
Pfam:GTP_EFTU 65 230 5.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162479
SMART Domains Protein: ENSMUSP00000124621
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:MMR_HSR1 104 141 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162512
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125352
Gene: ENSMUSG00000022668
AA Change: Y184C

DomainStartEndE-ValueType
Pfam:SRPRB 109 250 1.8e-7 PFAM
Pfam:MMR_HSR1 113 228 1.1e-18 PFAM
Meta Mutation Damage Score 0.9215 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Gtpbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Gtpbp8 APN 16 44740131 missense probably benign 0.14
R1938:Gtpbp8 UTSW 16 44745422 missense probably benign
R2152:Gtpbp8 UTSW 16 44740027 critical splice donor site probably null
R4349:Gtpbp8 UTSW 16 44746197 splice site probably null
R4851:Gtpbp8 UTSW 16 44746070 missense probably benign
R7250:Gtpbp8 UTSW 16 44743862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGTTGAGCTAGGCAGAAG -3'
(R):5'- AGGTTCATGAACATTTCTAGGCATG -3'

Sequencing Primer
(F):5'- AAAGGCAGTGTATACCCTGGTTCTC -3'
(R):5'- GAACATTTCTAGGCATGAAATAAAGG -3'
Posted On2015-02-19