Incidental Mutation 'R3607:Usp11'
ID269145
Institutional Source Beutler Lab
Gene Symbol Usp11
Ensembl Gene ENSMUSG00000031066
Gene Nameubiquitin specific peptidase 11
Synonyms
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location20703906-20720539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20714632 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 426 (F426L)
Ref Sequence ENSEMBL: ENSMUSP00000033383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033383]
Predicted Effect probably damaging
Transcript: ENSMUST00000033383
AA Change: F426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033383
Gene: ENSMUSG00000031066
AA Change: F426L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
DUSP 44 136 1.37e-36 SMART
Pfam:Ubiquitin_3 146 234 5.6e-14 PFAM
Pfam:UCH 256 886 5.1e-83 PFAM
Pfam:UCH_1 257 448 1.6e-7 PFAM
Pfam:UCH_1 658 868 2.9e-13 PFAM
low complexity region 898 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149960
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This gene encodes a deubiquitinating enzyme which lies in a gene cluster on chromosome Xp11.23 [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Usp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02037:Usp11 APN X 20719142 missense probably damaging 1.00
IGL02093:Usp11 APN X 20719352 missense probably benign 0.09
IGL02583:Usp11 APN X 20718045 missense probably benign 0.01
IGL03194:Usp11 APN X 20712417 missense probably benign 0.00
R1413:Usp11 UTSW X 20718707 missense probably damaging 1.00
R2926:Usp11 UTSW X 20717792 missense probably damaging 0.99
X0028:Usp11 UTSW X 20712090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTAGGCTTCAACAGTGTCC -3'
(R):5'- TCGTAGGTTAATGTAGAAAAGCGTG -3'

Sequencing Primer
(F):5'- AGGCTTCAACAGTGTCCTTTAC -3'
(R):5'- CGTGAGGGAAGTAATCAAAGGCTG -3'
Posted On2015-02-19