Mutagenetix > Incidental Mutation

Incidental Mutation 'R3608:Psmc3'

269149

Institutional Source

Beutler Lab

Gene Symbol

Psmc3

Ensembl Gene

ENSMUSG00000002102

Gene Name

proteasome (prosome, macropain) 26S subunit, ATPase 3

Synonyms

Tat binding protein 1, TBP-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90884361-90889783 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90884925 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 30 (D30E)

Ref Sequence

ENSEMBL: ENSMUSP00000107068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]

AlphaFold

O88685

Predicted Effect

probably benign
Transcript: ENSMUST00000002171
AA Change: D30E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102
AA Change: D30E

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067663
AA Change: D30E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102
AA Change: D30E

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART
Blast:AAA	390	436	9e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111441
AA Change: D30E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102
AA Change: D30E

Domain	Start	End	E-Value	Type
AAA	180	319	6.65e-22	SMART
Blast:AAA	348	394	8e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152269

Predicted Effect

probably benign
Transcript: ENSMUST00000185715
AA Change: D11E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102
AA Change: D11E

Domain	Start	End	E-Value	Type
AAA	203	301	9e-14	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000146506
AA Change: D12E

SMART Domains

Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102
AA Change: D12E

Domain	Start	End	E-Value	Type
PDB:4CR4\|M	13	183	2e-69	PDB
Blast:AAA	140	183	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146633

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
B3gnt4	C	A	5: 123,648,838 (GRCm39)	R68S	probably damaging	Het
Brf1	A	G	12: 112,924,894 (GRCm39)	L610P	probably benign	Het
Cacna1e	T	A	1: 154,291,831 (GRCm39)	R1783S	probably benign	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
CK137956	A	T	4: 127,845,119 (GRCm39)	I208N	probably damaging	Het
Col17a1	G	A	19: 47,668,844 (GRCm39)	L127F	probably benign	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Dlgap4	C	T	2: 156,590,332 (GRCm39)		probably benign	Het
Ect2l	A	T	10: 18,018,688 (GRCm39)	N619K	possibly damaging	Het
Hamp2	T	C	7: 30,623,539 (GRCm39)	T8A	probably benign	Het
Lamb1	T	A	12: 31,337,909 (GRCm39)	N407K	probably damaging	Het
Lrrc32	C	T	7: 98,148,393 (GRCm39)	T391M	probably benign	Het
Mroh2a	G	T	1: 88,172,717 (GRCm39)	A829S	probably damaging	Het
Ncoa1	T	C	12: 4,328,186 (GRCm39)	N884S	probably benign	Het
Neil1	T	C	9: 57,051,485 (GRCm39)	T278A	probably damaging	Het
Pcnx2	T	C	8: 126,614,840 (GRCm39)	T204A	probably benign	Het
Rtkn	T	A	6: 83,127,016 (GRCm39)	C328S	probably damaging	Het
Speer4f2	C	A	5: 17,579,492 (GRCm39)	T97K	probably benign	Het
Srd5a2	A	G	17: 74,334,026 (GRCm39)	V131A	probably benign	Het
Tm9sf4	A	G	2: 153,020,897 (GRCm39)	H35R	probably benign	Het
Ubr2	G	T	17: 47,255,449 (GRCm39)	D1412E	probably damaging	Het
Vmn2r95	G	A	17: 18,660,235 (GRCm39)	V216I	possibly damaging	Het
Ypel1	A	T	16: 16,910,154 (GRCm39)	C126*	probably null	Het

Other mutations in Psmc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
E0370:Psmc3	UTSW	2	90,885,463 (GRCm39)	splice site	probably null
R0747:Psmc3	UTSW	2	90,884,645 (GRCm39)	missense	probably benign	0.10
R1182:Psmc3	UTSW	2	90,886,380 (GRCm39)	missense	probably damaging	1.00
R1763:Psmc3	UTSW	2	90,886,340 (GRCm39)	missense	possibly damaging	0.81
R1967:Psmc3	UTSW	2	90,888,189 (GRCm39)	missense	probably benign	0.19
R2056:Psmc3	UTSW	2	90,888,433 (GRCm39)	missense	probably benign	0.40
R2484:Psmc3	UTSW	2	90,886,346 (GRCm39)	missense	probably damaging	0.97
R3411:Psmc3	UTSW	2	90,886,263 (GRCm39)	missense	probably damaging	1.00
R4917:Psmc3	UTSW	2	90,896,317 (GRCm39)	unclassified	probably benign
R4954:Psmc3	UTSW	2	90,885,974 (GRCm39)	intron	probably benign
R5033:Psmc3	UTSW	2	90,884,953 (GRCm39)	missense	probably benign	0.03
R5073:Psmc3	UTSW	2	90,884,915 (GRCm39)	splice site	probably benign
R5279:Psmc3	UTSW	2	90,884,667 (GRCm39)	missense	probably benign
R5354:Psmc3	UTSW	2	90,889,698 (GRCm39)	missense	probably damaging	1.00
R6169:Psmc3	UTSW	2	90,888,184 (GRCm39)	missense	probably damaging	1.00
R6224:Psmc3	UTSW	2	90,884,975 (GRCm39)	missense	probably damaging	1.00
R7039:Psmc3	UTSW	2	90,885,391 (GRCm39)	missense	probably benign	0.32
R7275:Psmc3	UTSW	2	90,886,275 (GRCm39)	missense	probably damaging	0.97
R7962:Psmc3	UTSW	2	90,887,007 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TTAGACGTTCTTGGAGGCCG -3'
(R):5'- GACAGGGCTAGGTATTTTCCATGG -3'

Sequencing Primer
(F):5'- TTCTTGGAGGCCGGGAAAG -3'
(R):5'- GGTTTGAGTGTGAATTCATCCCTCTC -3'

Posted On

2015-02-19