Incidental Mutation 'R3608:CK137956'
ID269152
Institutional Source Beutler Lab
Gene Symbol CK137956
Ensembl Gene ENSMUSG00000028813
Gene NamecDNA sequence CK137956
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3608 (G1)
Quality Score204
Status Not validated
Chromosome4
Chromosomal Location127927592-127970951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127951326 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 208 (I208N)
Ref Sequence ENSEMBL: ENSMUSP00000030614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030614]
Predicted Effect probably damaging
Transcript: ENSMUST00000030614
AA Change: I208N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030614
Gene: ENSMUSG00000028813
AA Change: I208N

DomainStartEndE-ValueType
Pfam:DUF4688 197 596 3.8e-249 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,510,775 R68S probably damaging Het
Brf1 A G 12: 112,961,274 L610P probably benign Het
Cacna1e T A 1: 154,416,085 R1783S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Col17a1 G A 19: 47,680,405 L127F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlgap4 C T 2: 156,748,412 probably benign Het
Ect2l A T 10: 18,142,940 N619K possibly damaging Het
Hamp2 T C 7: 30,924,114 T8A probably benign Het
Lamb1 T A 12: 31,287,910 N407K probably damaging Het
Lrrc32 C T 7: 98,499,186 T391M probably benign Het
Mroh2a G T 1: 88,244,995 A829S probably damaging Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Pcnx2 T C 8: 125,888,101 T204A probably benign Het
Ppil2 A T 16: 17,092,290 C126* probably null Het
Psmc3 T A 2: 91,054,580 D30E probably benign Het
Rtkn T A 6: 83,150,035 C328S probably damaging Het
Speer4f2 C A 5: 17,374,494 T97K probably benign Het
Srd5a2 A G 17: 74,027,031 V131A probably benign Het
Tm9sf4 A G 2: 153,178,977 H35R probably benign Het
Ubr2 G T 17: 46,944,523 D1412E probably damaging Het
Vmn2r95 G A 17: 18,439,973 V216I possibly damaging Het
Other mutations in CK137956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:CK137956 APN 4 127935850 missense probably benign
IGL01365:CK137956 APN 4 127951342 missense probably benign 0.01
IGL01563:CK137956 APN 4 127970635 missense possibly damaging 0.94
IGL01834:CK137956 APN 4 127946649 missense probably damaging 1.00
R0117:CK137956 UTSW 4 127946792 missense possibly damaging 0.63
R0456:CK137956 UTSW 4 127945307 missense probably damaging 0.99
R0492:CK137956 UTSW 4 127951300 missense probably benign 0.03
R1793:CK137956 UTSW 4 127951449 missense probably benign
R1869:CK137956 UTSW 4 127970534 missense possibly damaging 0.92
R1932:CK137956 UTSW 4 127946858 missense possibly damaging 0.89
R2011:CK137956 UTSW 4 127951036 missense probably benign 0.25
R2030:CK137956 UTSW 4 127951387 missense probably benign 0.23
R2032:CK137956 UTSW 4 127945276 missense probably benign 0.38
R2135:CK137956 UTSW 4 127951640 splice site probably benign
R2994:CK137956 UTSW 4 127951507 missense probably benign 0.03
R3895:CK137956 UTSW 4 127946648 missense probably benign 0.01
R4165:CK137956 UTSW 4 127970729 missense possibly damaging 0.83
R5610:CK137956 UTSW 4 127946647 critical splice donor site probably null
R6861:CK137956 UTSW 4 127970726 missense probably damaging 0.98
R7149:CK137956 UTSW 4 127970833 start codon destroyed probably null 0.53
R8132:CK137956 UTSW 4 127951282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCGGAGCCATTGAACATG -3'
(R):5'- ACCCATTGTTACTCCCCAGG -3'

Sequencing Primer
(F):5'- CTGCAGGAAGTCCTTAATGACCTTG -3'
(R):5'- AATGGCTGGTGACGAGAT -3'
Posted On2015-02-19