Mutagenetix > Incidental Mutation

Incidental Mutation 'R3608:Speer4f2'

269153

Institutional Source

Beutler Lab

Gene Symbol

Speer4f2

Ensembl Gene

ENSMUSG00000091827

Gene Name

spermatogenesis associated glutamate (E)-rich protein 4f2

Synonyms

Gm3535, Gm3495

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R3608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17373180-17378028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 17374494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 97 (T97K)

Ref Sequence

ENSEMBL: ENSMUSP00000129818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166086]

AlphaFold

E9Q366

Predicted Effect

probably benign
Transcript: ENSMUST00000166086
AA Change: T97K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: T97K

Domain	Start	End	E-Value	Type
Pfam:Takusan	34	112	9.6e-20	PFAM
low complexity region	208	253	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
B3gnt4	C	A	5: 123,510,775	R68S	probably damaging	Het
Brf1	A	G	12: 112,961,274	L610P	probably benign	Het
Cacna1e	T	A	1: 154,416,085	R1783S	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
CK137956	A	T	4: 127,951,326	I208N	probably damaging	Het
Col17a1	G	A	19: 47,680,405	L127F	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dlgap4	C	T	2: 156,748,412		probably benign	Het
Ect2l	A	T	10: 18,142,940	N619K	possibly damaging	Het
Hamp2	T	C	7: 30,924,114	T8A	probably benign	Het
Lamb1	T	A	12: 31,287,910	N407K	probably damaging	Het
Lrrc32	C	T	7: 98,499,186	T391M	probably benign	Het
Mroh2a	G	T	1: 88,244,995	A829S	probably damaging	Het
Ncoa1	T	C	12: 4,278,186	N884S	probably benign	Het
Neil1	T	C	9: 57,144,201	T278A	probably damaging	Het
Pcnx2	T	C	8: 125,888,101	T204A	probably benign	Het
Ppil2	A	T	16: 17,092,290	C126*	probably null	Het
Psmc3	T	A	2: 91,054,580	D30E	probably benign	Het
Rtkn	T	A	6: 83,150,035	C328S	probably damaging	Het
Srd5a2	A	G	17: 74,027,031	V131A	probably benign	Het
Tm9sf4	A	G	2: 153,178,977	H35R	probably benign	Het
Ubr2	G	T	17: 46,944,523	D1412E	probably damaging	Het
Vmn2r95	G	A	17: 18,439,973	V216I	possibly damaging	Het

Other mutations in Speer4f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01505:Speer4f2	APN	5	17376567	missense	possibly damaging	0.94
IGL02092:Speer4f2	APN	5	17376629	nonsense	probably null
IGL03100:Speer4f2	APN	5	17376530	missense	probably damaging	0.99
R0939:Speer4f2	UTSW	5	17374404	missense	probably damaging	0.99
R1384:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R1528:Speer4f2	UTSW	5	17376542	missense
R1873:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R4972:Speer4f2	UTSW	5	17374425	missense	probably benign	0.27
R5421:Speer4f2	UTSW	5	17374358	missense	possibly damaging	0.88
R5450:Speer4f2	UTSW	5	17373219	missense	possibly damaging	0.85
R5452:Speer4f2	UTSW	5	17376500	missense	possibly damaging	0.93
R5531:Speer4f2	UTSW	5	17376528	missense	possibly damaging	0.57
R5924:Speer4f2	UTSW	5	17376624	missense	probably damaging	1.00
R6454:Speer4f2	UTSW	5	17374433	missense	probably damaging	0.99
R6553:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6585:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6649:Speer4f2	UTSW	5	17375769	missense	probably benign	0.05
R6878:Speer4f2	UTSW	5	17375767	missense	probably damaging	0.99
R7089:Speer4f2	UTSW	5	17376663	missense
R7129:Speer4f2	UTSW	5	17377448	missense
R7448:Speer4f2	UTSW	5	17376542	missense
R7654:Speer4f2	UTSW	5	17374415	missense
R7942:Speer4f2	UTSW	5	17377632	missense	unknown
R8170:Speer4f2	UTSW	5	17374461	missense
R8409:Speer4f2	UTSW	5	17377421	missense
R9154:Speer4f2	UTSW	5	17376612	missense

Predicted Primers

PCR Primer
(F):5'- GGCATGTATTCCTTCTCTGTAGACAG -3'
(R):5'- TCCTGACAAAGCTTCAGGCC -3'

Sequencing Primer
(F):5'- CTGTAGACAGTCTAAACTCTTTGC -3'
(R):5'- GGCCTTGCCTCTCCTTTAAAAAGTG -3'

Posted On

2015-02-19