Incidental Mutation 'R3608:Hamp2'
ID 269158
Institutional Source Beutler Lab
Gene Symbol Hamp2
Ensembl Gene ENSMUSG00000056978
Gene Name hepcidin antimicrobial peptide 2
Synonyms 1810073K19Rik, HEPC2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R3608 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30621797-30623606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30623539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000151677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074671] [ENSMUST00000217812]
AlphaFold Q80T19
Predicted Effect probably benign
Transcript: ENSMUST00000074671
AA Change: T7A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074240
Gene: ENSMUSG00000056978
AA Change: T7A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Hepcidin 33 84 9.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206970
Predicted Effect probably benign
Transcript: ENSMUST00000217812
AA Change: T8A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a peptide hormone that functions in the regulation of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Transgenic mice overexpressing the encoded protein develop normally with hematologic parameters similar to the non-transgenic mice. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,648,838 (GRCm39) R68S probably damaging Het
Brf1 A G 12: 112,924,894 (GRCm39) L610P probably benign Het
Cacna1e T A 1: 154,291,831 (GRCm39) R1783S probably benign Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
CK137956 A T 4: 127,845,119 (GRCm39) I208N probably damaging Het
Col17a1 G A 19: 47,668,844 (GRCm39) L127F probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Dlgap4 C T 2: 156,590,332 (GRCm39) probably benign Het
Ect2l A T 10: 18,018,688 (GRCm39) N619K possibly damaging Het
Lamb1 T A 12: 31,337,909 (GRCm39) N407K probably damaging Het
Lrrc32 C T 7: 98,148,393 (GRCm39) T391M probably benign Het
Mroh2a G T 1: 88,172,717 (GRCm39) A829S probably damaging Het
Ncoa1 T C 12: 4,328,186 (GRCm39) N884S probably benign Het
Neil1 T C 9: 57,051,485 (GRCm39) T278A probably damaging Het
Pcnx2 T C 8: 126,614,840 (GRCm39) T204A probably benign Het
Psmc3 T A 2: 90,884,925 (GRCm39) D30E probably benign Het
Rtkn T A 6: 83,127,016 (GRCm39) C328S probably damaging Het
Speer4f2 C A 5: 17,579,492 (GRCm39) T97K probably benign Het
Srd5a2 A G 17: 74,334,026 (GRCm39) V131A probably benign Het
Tm9sf4 A G 2: 153,020,897 (GRCm39) H35R probably benign Het
Ubr2 G T 17: 47,255,449 (GRCm39) D1412E probably damaging Het
Vmn2r95 G A 17: 18,660,235 (GRCm39) V216I possibly damaging Het
Ypel1 A T 16: 16,910,154 (GRCm39) C126* probably null Het
Other mutations in Hamp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Hamp2 APN 7 30,622,122 (GRCm39) missense probably damaging 0.96
R0571:Hamp2 UTSW 7 30,623,511 (GRCm39) missense possibly damaging 0.96
R6607:Hamp2 UTSW 7 30,622,013 (GRCm39) nonsense probably null
R7393:Hamp2 UTSW 7 30,622,030 (GRCm39) missense possibly damaging 0.73
R8709:Hamp2 UTSW 7 30,621,974 (GRCm39) missense probably damaging 0.98
R8944:Hamp2 UTSW 7 30,622,001 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCAAGGACACCTGTGCAGC -3'
(R):5'- CACCACTATCTTCTTGGAATTGAG -3'

Sequencing Primer
(F):5'- AAGGACCACCCTCTTCCTTG -3'
(R):5'- CTATCTTCTTGGAATTGAGTCAAGGC -3'
Posted On 2015-02-19