Incidental Mutation 'R3608:Hamp2'
ID269158
Institutional Source Beutler Lab
Gene Symbol Hamp2
Ensembl Gene ENSMUSG00000056978
Gene Namehepcidin antimicrobial peptide 2
SynonymsHEPC2, 1810073K19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3608 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30922372-30924681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30924114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000151677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074671] [ENSMUST00000217812]
Predicted Effect probably benign
Transcript: ENSMUST00000074671
AA Change: T7A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074240
Gene: ENSMUSG00000056978
AA Change: T7A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Hepcidin 33 84 9.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206970
Predicted Effect probably benign
Transcript: ENSMUST00000217812
AA Change: T8A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a peptide hormone that functions in the regulation of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Transgenic mice overexpressing the encoded protein develop normally with hematologic parameters similar to the non-transgenic mice. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,510,775 R68S probably damaging Het
Brf1 A G 12: 112,961,274 L610P probably benign Het
Cacna1e T A 1: 154,416,085 R1783S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
CK137956 A T 4: 127,951,326 I208N probably damaging Het
Col17a1 G A 19: 47,680,405 L127F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlgap4 C T 2: 156,748,412 probably benign Het
Ect2l A T 10: 18,142,940 N619K possibly damaging Het
Lamb1 T A 12: 31,287,910 N407K probably damaging Het
Lrrc32 C T 7: 98,499,186 T391M probably benign Het
Mroh2a G T 1: 88,244,995 A829S probably damaging Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Pcnx2 T C 8: 125,888,101 T204A probably benign Het
Ppil2 A T 16: 17,092,290 C126* probably null Het
Psmc3 T A 2: 91,054,580 D30E probably benign Het
Rtkn T A 6: 83,150,035 C328S probably damaging Het
Speer4f2 C A 5: 17,374,494 T97K probably benign Het
Srd5a2 A G 17: 74,027,031 V131A probably benign Het
Tm9sf4 A G 2: 153,178,977 H35R probably benign Het
Ubr2 G T 17: 46,944,523 D1412E probably damaging Het
Vmn2r95 G A 17: 18,439,973 V216I possibly damaging Het
Other mutations in Hamp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Hamp2 APN 7 30922697 missense probably damaging 0.96
R0571:Hamp2 UTSW 7 30924086 missense possibly damaging 0.96
R6607:Hamp2 UTSW 7 30922588 nonsense probably null
R7393:Hamp2 UTSW 7 30922605 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCAAGGACACCTGTGCAGC -3'
(R):5'- CACCACTATCTTCTTGGAATTGAG -3'

Sequencing Primer
(F):5'- AAGGACCACCCTCTTCCTTG -3'
(R):5'- CTATCTTCTTGGAATTGAGTCAAGGC -3'
Posted On2015-02-19