Incidental Mutation 'R3608:Neil1'
ID269162
Institutional Source Beutler Lab
Gene Symbol Neil1
Ensembl Gene ENSMUSG00000032298
Gene Namenei endonuclease VIII-like 1 (E. coli)
Synonyms2810450N13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R3608 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57142800-57148305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57144201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 278 (T278A)
Ref Sequence ENSEMBL: ENSMUSP00000139917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000034842] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000161182] [ENSMUST00000161663] [ENSMUST00000186410] [ENSMUST00000190245]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034842
AA Change: T278A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034842
Gene: ENSMUSG00000032298
AA Change: T278A

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect probably benign
Transcript: ENSMUST00000160147
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161663
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably damaging
Transcript: ENSMUST00000186410
AA Change: T278A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141048
Gene: ENSMUSG00000032298
AA Change: T278A

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190245
AA Change: T278A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298
AA Change: T278A

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nei endonuclease VIII-like gene family which encodes DNA glycosylases. The encoded enzyme participates in the DNA repair pathway by initiating base excision repair by removing damaged bases, primarily oxidized pyrimidines. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice develop severe obesity, dyslipidemia, fatty liver disease and tend to show hyperinsulinemia and increased mtDNA damage and deletions. Sporadic phenotypes include reduced subcutaneous fat, skin ulcers, joint inflammation, infertility,and tumors. Male heterozygotes become obese. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,510,775 R68S probably damaging Het
Brf1 A G 12: 112,961,274 L610P probably benign Het
Cacna1e T A 1: 154,416,085 R1783S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
CK137956 A T 4: 127,951,326 I208N probably damaging Het
Col17a1 G A 19: 47,680,405 L127F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlgap4 C T 2: 156,748,412 probably benign Het
Ect2l A T 10: 18,142,940 N619K possibly damaging Het
Hamp2 T C 7: 30,924,114 T8A probably benign Het
Lamb1 T A 12: 31,287,910 N407K probably damaging Het
Lrrc32 C T 7: 98,499,186 T391M probably benign Het
Mroh2a G T 1: 88,244,995 A829S probably damaging Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Pcnx2 T C 8: 125,888,101 T204A probably benign Het
Ppil2 A T 16: 17,092,290 C126* probably null Het
Psmc3 T A 2: 91,054,580 D30E probably benign Het
Rtkn T A 6: 83,150,035 C328S probably damaging Het
Speer4f2 C A 5: 17,374,494 T97K probably benign Het
Srd5a2 A G 17: 74,027,031 V131A probably benign Het
Tm9sf4 A G 2: 153,178,977 H35R probably benign Het
Ubr2 G T 17: 46,944,523 D1412E probably damaging Het
Vmn2r95 G A 17: 18,439,973 V216I possibly damaging Het
Other mutations in Neil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Neil1 APN 9 57143977 critical splice donor site probably null
IGL02587:Neil1 APN 9 57144979 missense probably damaging 1.00
IGL03192:Neil1 APN 9 57143535 missense probably benign
R0138:Neil1 UTSW 9 57143746 splice site probably benign
R0348:Neil1 UTSW 9 57146781 splice site probably null
R0356:Neil1 UTSW 9 57146896 missense possibly damaging 0.57
R1280:Neil1 UTSW 9 57146901 missense probably damaging 1.00
R1835:Neil1 UTSW 9 57146604 missense probably damaging 1.00
R1853:Neil1 UTSW 9 57144715 missense probably damaging 0.98
R1942:Neil1 UTSW 9 57146607 missense probably benign 0.00
R2272:Neil1 UTSW 9 57146785 missense probably damaging 1.00
R3116:Neil1 UTSW 9 57146663 missense probably benign
R3713:Neil1 UTSW 9 57146970 missense probably damaging 1.00
R4883:Neil1 UTSW 9 57146922 missense probably damaging 1.00
R5744:Neil1 UTSW 9 57144201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGAGTCAACCTGGTTTG -3'
(R):5'- ACAGGCCTAGTCACAGTGAGAG -3'

Sequencing Primer
(F):5'- AGTCAACCTGGTTTGATGAAGG -3'
(R):5'- AGGTTGAACCAGGCTCACTGTTC -3'
Posted On2015-02-19