Incidental Mutation 'R3609:Olfr1256'
ID269180
Institutional Source Beutler Lab
Gene Symbol Olfr1256
Ensembl Gene ENSMUSG00000075073
Gene Nameolfactory receptor 1256
SynonymsGA_x6K02T2Q125-51276848-51275928, MOR231-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89825311-89841555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89835076 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 290 (S290P)
Ref Sequence ENSEMBL: ENSMUSP00000149123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099763] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000215613]
Predicted Effect probably damaging
Transcript: ENSMUST00000099763
AA Change: S290P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097351
Gene: ENSMUSG00000075073
AA Change: S290P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 5.3e-28 PFAM
Pfam:7tm_4 137 278 7.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111520
AA Change: S290P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073
AA Change: S290P

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213833
AA Change: S290P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215613
AA Change: S290P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,558 T48I possibly damaging Het
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Ces1c A T 8: 93,120,332 I98N probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Irak3 G T 10: 120,145,677 T441K possibly damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Vmn2r71 T A 7: 85,619,662 C358S probably damaging Het
Other mutations in Olfr1256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Olfr1256 APN 2 89835458 nonsense probably null
IGL01082:Olfr1256 APN 2 89844063 unclassified probably benign
IGL01613:Olfr1256 APN 2 89835808 missense probably damaging 0.98
IGL01969:Olfr1256 APN 2 89835720 missense probably benign 0.01
IGL02625:Olfr1256 APN 2 89835396 missense probably damaging 1.00
R0843:Olfr1256 UTSW 2 89835616 missense probably benign 0.01
R1270:Olfr1256 UTSW 2 89835322 missense possibly damaging 0.90
R1521:Olfr1256 UTSW 2 89835172 nonsense probably null
R2219:Olfr1256 UTSW 2 89835425 missense probably damaging 1.00
R2881:Olfr1256 UTSW 2 89844984 splice site probably null
R3121:Olfr1256 UTSW 2 89835514 missense probably benign
R4984:Olfr1256 UTSW 2 89835813 missense probably damaging 1.00
R5153:Olfr1256 UTSW 2 89835234 missense possibly damaging 0.77
R5640:Olfr1256 UTSW 2 89835938 missense probably benign 0.08
R7198:Olfr1256 UTSW 2 89835732 missense probably damaging 1.00
R7862:Olfr1256 UTSW 2 89835124 missense probably benign 0.16
R8100:Olfr1256 UTSW 2 89835685 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGTCCAGGTATAGTGATAAACAAG -3'
(R):5'- AAGGGAGGTGGAAAGCTCTCTC -3'

Sequencing Primer
(F):5'- AGTAGTTCAACCACTGATTTTAGTTG -3'
(R):5'- AGGTGGAAAGCTCTCTCTACCTG -3'
Posted On2015-02-19