Incidental Mutation 'R3609:Vmn2r71'
ID269185
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85619662 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 358 (C358S)
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect probably damaging
Transcript: ENSMUST00000172338
AA Change: C358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: C358S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208545
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,558 T48I possibly damaging Het
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Ces1c A T 8: 93,120,332 I98N probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Irak3 G T 10: 120,145,677 T441K possibly damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr1256 A G 2: 89,835,076 S290P probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0865:Vmn2r71 UTSW 7 85619308 missense probably benign 0.01
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3122:Vmn2r71 UTSW 7 85615620 nonsense probably null
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4569:Vmn2r71 UTSW 7 85624194 missense possibly damaging 0.66
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R5831:Vmn2r71 UTSW 7 85623714 missense probably benign 0.16
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6751:Vmn2r71 UTSW 7 85619887 critical splice donor site probably null
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
R7358:Vmn2r71 UTSW 7 85624260 missense possibly damaging 0.81
R7453:Vmn2r71 UTSW 7 85624089 missense probably benign 0.21
R7560:Vmn2r71 UTSW 7 85623907 missense probably benign 0.06
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCATGGAAATCTCAAGGC -3'
(R):5'- GACCATGTGTCTACTTCTTGCAG -3'

Sequencing Primer
(F):5'- AGAATCTGGGTTAGTGCATCAC -3'
(R):5'- GCAGAAGCATCTCATGAAGTG -3'
Posted On2015-02-19