Incidental Mutation 'R3609:Ces1c'
ID269187
Institutional Source Beutler Lab
Gene Symbol Ces1c
Ensembl Gene ENSMUSG00000057400
Gene Namecarboxylesterase 1C
SynonymsEs-4, Ces-N, Es1, Es-N, Ee-1, Es-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93099015-93131283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93120332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 98 (I98N)
Ref Sequence ENSEMBL: ENSMUSP00000148619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034189] [ENSMUST00000211843]
Predicted Effect probably damaging
Transcript: ENSMUST00000034189
AA Change: I244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034189
Gene: ENSMUSG00000057400
AA Change: I244N

DomainStartEndE-ValueType
Pfam:COesterase 1 534 4e-167 PFAM
Pfam:Abhydrolase_3 136 235 6.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131822
AA Change: H252Q
Predicted Effect probably damaging
Transcript: ENSMUST00000134161
AA Change: I98N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123146
Gene: ENSMUSG00000057400
AA Change: I98N

DomainStartEndE-ValueType
Pfam:Abhydrolase_3 1 140 3.2e-7 PFAM
Pfam:COesterase 1 177 4.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211843
AA Change: I98N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212091
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against nerve agents such as chlorpyrifos and chlorpyrifos oxon but increased sensitivity to soman coumarin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,558 T48I possibly damaging Het
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Irak3 G T 10: 120,145,677 T441K possibly damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr1256 A G 2: 89,835,076 S290P probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Vmn2r71 T A 7: 85,619,662 C358S probably damaging Het
Other mutations in Ces1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ces1c APN 8 93106673 missense probably benign 0.02
IGL00558:Ces1c APN 8 93099271 missense probably benign 0.03
IGL00787:Ces1c APN 8 93120366 missense possibly damaging 0.90
IGL00851:Ces1c APN 8 93123117 missense probably benign 0.00
IGL01598:Ces1c APN 8 93118413 missense probably benign
IGL02616:Ces1c APN 8 93106615 missense probably benign 0.01
IGL03087:Ces1c APN 8 93118414 missense probably benign
IGL03203:Ces1c APN 8 93124588 missense probably damaging 1.00
R0119:Ces1c UTSW 8 93106717 unclassified probably benign
R0119:Ces1c UTSW 8 93107610 missense probably benign 0.00
R0255:Ces1c UTSW 8 93127524 missense probably benign
R0759:Ces1c UTSW 8 93130864 nonsense probably null
R1499:Ces1c UTSW 8 93127605 missense probably benign 0.01
R1926:Ces1c UTSW 8 93127604 missense possibly damaging 0.69
R2087:Ces1c UTSW 8 93107602 missense probably benign 0.00
R2142:Ces1c UTSW 8 93130840 missense probably benign
R2442:Ces1c UTSW 8 93123212 missense probably damaging 1.00
R2971:Ces1c UTSW 8 93104193 missense probably benign 0.01
R3079:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3080:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R4131:Ces1c UTSW 8 93100684 missense probably damaging 1.00
R4633:Ces1c UTSW 8 93118386 missense probably benign 0.00
R4988:Ces1c UTSW 8 93100708 missense probably damaging 1.00
R5081:Ces1c UTSW 8 93127569 missense probably damaging 1.00
R5497:Ces1c UTSW 8 93130715 missense possibly damaging 0.91
R5586:Ces1c UTSW 8 93127599 missense probably benign 0.00
R7013:Ces1c UTSW 8 93130764 missense probably damaging 1.00
R7137:Ces1c UTSW 8 93130842 missense probably benign 0.02
R7611:Ces1c UTSW 8 93124511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATAGTCCTTCTGCCTAGCTG -3'
(R):5'- CAAGAATGCAGCTGCCATTAG -3'

Sequencing Primer
(F):5'- AGTCCTTCTGCCTAGCTGTTTTTAAG -3'
(R):5'- GAATGCAGCTGCCATTAGACATCTTC -3'
Posted On2015-02-19