Incidental Mutation 'R3609:Irak3'
ID269189
Institutional Source Beutler Lab
Gene Symbol Irak3
Ensembl Gene ENSMUSG00000020227
Gene Nameinterleukin-1 receptor-associated kinase 3
Synonyms4833428C18Rik, IRAK-M
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location120141648-120202130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120145677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 441 (T441K)
Ref Sequence ENSEMBL: ENSMUSP00000020448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020448] [ENSMUST00000135106] [ENSMUST00000145665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020448
AA Change: T441K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020448
Gene: ENSMUSG00000020227
AA Change: T441K

DomainStartEndE-ValueType
Pfam:Death 26 106 1.3e-15 PFAM
Pfam:Pkinase 178 456 8.4e-37 PFAM
Pfam:Pkinase_Tyr 178 456 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135106
SMART Domains Protein: ENSMUSP00000123604
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Death 26 106 2.2e-16 PFAM
Pfam:Pkinase_Tyr 178 301 3.1e-15 PFAM
Pfam:Pkinase 178 302 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145665
AA Change: T349K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118038
Gene: ENSMUSG00000020227
AA Change: T349K

DomainStartEndE-ValueType
Pfam:Pkinase 86 364 8.4e-35 PFAM
Pfam:Pkinase_Tyr 86 364 1.7e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory responses to bacterial infections and loose bone mass with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,558 T48I possibly damaging Het
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Ces1c A T 8: 93,120,332 I98N probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr1256 A G 2: 89,835,076 S290P probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Vmn2r71 T A 7: 85,619,662 C358S probably damaging Het
Other mutations in Irak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Irak3 APN 10 120178067 critical splice donor site probably null
IGL01015:Irak3 APN 10 120142790 nonsense probably null
IGL01530:Irak3 APN 10 120142794 missense probably benign 0.10
IGL01641:Irak3 APN 10 120176347 missense probably benign 0.35
IGL01730:Irak3 APN 10 120178100 missense probably benign 0.04
IGL02054:Irak3 APN 10 120176259 missense probably benign 0.01
IGL02938:Irak3 APN 10 120182524 critical splice donor site probably null
IGL02954:Irak3 APN 10 120176242 missense probably damaging 0.98
IGL02992:Irak3 APN 10 120182661 missense probably damaging 1.00
IGL03376:Irak3 APN 10 120146636 splice site probably benign
iracema UTSW 10 120145782 missense probably damaging 0.99
R0031:Irak3 UTSW 10 120176320 nonsense probably null
R0734:Irak3 UTSW 10 120145637 splice site probably benign
R1017:Irak3 UTSW 10 120142884 missense possibly damaging 0.94
R1025:Irak3 UTSW 10 120176346 missense probably damaging 1.00
R1486:Irak3 UTSW 10 120143061 missense probably damaging 1.00
R1538:Irak3 UTSW 10 120165130 missense probably benign 0.00
R1596:Irak3 UTSW 10 120182546 missense probably damaging 1.00
R1689:Irak3 UTSW 10 120146552 missense probably damaging 0.98
R2133:Irak3 UTSW 10 120165177 missense probably benign 0.10
R3947:Irak3 UTSW 10 120170373 missense probably benign 0.00
R3948:Irak3 UTSW 10 120170373 missense probably benign 0.00
R4510:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4511:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4885:Irak3 UTSW 10 120182681 missense probably damaging 1.00
R5007:Irak3 UTSW 10 120146429 critical splice donor site probably null
R5180:Irak3 UTSW 10 120145782 missense probably damaging 0.99
R5704:Irak3 UTSW 10 120145689 missense probably benign 0.04
R5715:Irak3 UTSW 10 120142736 missense possibly damaging 0.66
R6020:Irak3 UTSW 10 120143137 missense probably damaging 1.00
R6916:Irak3 UTSW 10 120201365 missense probably damaging 1.00
R7182:Irak3 UTSW 10 120166511 missense probably damaging 1.00
R7707:Irak3 UTSW 10 120146584 missense probably damaging 0.99
R7787:Irak3 UTSW 10 120176351 missense probably benign 0.06
X0023:Irak3 UTSW 10 120143187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTCTACAACCACAGC -3'
(R):5'- GTTGTCTGATAGAGTCCCAGG -3'

Sequencing Primer
(F):5'- TTCTACAACCACAGCAGGAGTGTG -3'
(R):5'- TGATAGAGTCCCAGGAATCAACTCTG -3'
Posted On2015-02-19