Incidental Mutation 'R3610:Dcaf10'
ID269198
Institutional Source Beutler Lab
Gene Symbol Dcaf10
Ensembl Gene ENSMUSG00000035572
Gene NameDDB1 and CUL4 associated factor 10
SynonymsWdr32
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location45342101-45379759 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 45372962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 409 (E409*)
Ref Sequence ENSEMBL: ENSMUSP00000117082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153803] [ENSMUST00000155551]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130821
Predicted Effect probably null
Transcript: ENSMUST00000153803
AA Change: E68*
SMART Domains Protein: ENSMUSP00000121616
Gene: ENSMUSG00000035572
AA Change: E68*

DomainStartEndE-ValueType
Blast:WD40 1 30 3e-11 BLAST
Blast:WD40 127 165 2e-10 BLAST
WD40 183 222 1.31e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155551
AA Change: E409*
SMART Domains Protein: ENSMUSP00000117082
Gene: ENSMUSG00000035572
AA Change: E409*

DomainStartEndE-ValueType
low complexity region 15 46 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
WD40 166 203 1.71e1 SMART
WD40 206 245 7.85e-7 SMART
WD40 249 288 2.59e-7 SMART
WD40 295 334 2.05e1 SMART
low complexity region 352 374 N/A INTRINSIC
Blast:WD40 468 506 3e-10 BLAST
WD40 524 563 1.31e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Dcaf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Dcaf10 APN 4 45342630 missense probably benign 0.01
IGL02660:Dcaf10 APN 4 45372769 missense possibly damaging 0.92
R0048:Dcaf10 UTSW 4 45374262 nonsense probably null
R0550:Dcaf10 UTSW 4 45372753 missense probably benign
R0611:Dcaf10 UTSW 4 45373011 missense probably damaging 1.00
R2289:Dcaf10 UTSW 4 45359816 missense probably damaging 1.00
R2973:Dcaf10 UTSW 4 45373957 missense probably benign 0.04
R3735:Dcaf10 UTSW 4 45348117 missense probably benign 0.01
R4655:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4665:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4690:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4724:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4725:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4735:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4743:Dcaf10 UTSW 4 45370409 missense probably damaging 0.98
R5220:Dcaf10 UTSW 4 45373909 missense possibly damaging 0.94
R5254:Dcaf10 UTSW 4 45370415 missense possibly damaging 0.94
R5855:Dcaf10 UTSW 4 45342558 missense probably benign 0.18
R6833:Dcaf10 UTSW 4 45373043 missense probably damaging 1.00
R7132:Dcaf10 UTSW 4 45342391 missense probably benign
R7345:Dcaf10 UTSW 4 45342583 missense probably damaging 0.98
R7366:Dcaf10 UTSW 4 45373919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTCTCGAGCCTCTCAAC -3'
(R):5'- TTACCAGCCTAAGGTCTGAAC -3'

Sequencing Primer
(F):5'- GTCTCGAGCCTCTCAACGAGAAG -3'
(R):5'- GCCTAAGGTCTGAACATGGACATC -3'
Posted On2015-02-19