Mutagenetix > Incidental Mutations

Incidental Mutation 'R3610:Dcaf10'

269198

Institutional Source

Beutler Lab

Gene Symbol

Dcaf10

Ensembl Gene

ENSMUSG00000035572

Gene Name

DDB1 and CUL4 associated factor 10

Synonyms

Wdr32

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45342101-45379759 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 45372962 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 409 (E409*)

Ref Sequence

ENSEMBL: ENSMUSP00000117082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153803] [ENSMUST00000155551]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130821

Predicted Effect

probably null
Transcript: ENSMUST00000153803
AA Change: E68*

SMART Domains

Protein: ENSMUSP00000121616
Gene: ENSMUSG00000035572
AA Change: E68*

Domain	Start	End	E-Value	Type
Blast:WD40	1	30	3e-11	BLAST
Blast:WD40	127	165	2e-10	BLAST
WD40	183	222	1.31e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000155551
AA Change: E409*

SMART Domains

Protein: ENSMUSP00000117082
Gene: ENSMUSG00000035572
AA Change: E409*

Domain	Start	End	E-Value	Type
low complexity region	15	46	N/A	INTRINSIC
low complexity region	80	107	N/A	INTRINSIC
low complexity region	110	132	N/A	INTRINSIC
WD40	166	203	1.71e1	SMART
WD40	206	245	7.85e-7	SMART
WD40	249	288	2.59e-7	SMART
WD40	295	334	2.05e1	SMART
low complexity region	352	374	N/A	INTRINSIC
Blast:WD40	468	506	3e-10	BLAST
WD40	524	563	1.31e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsf2	C	A	11: 94,561,346	V457L	probably benign	Het
Cacna1a	C	A	8: 84,559,065	R733S	probably damaging	Het
Cc2d2a	A	T	5: 43,712,326	E856D	probably damaging	Het
Cpeb2	T	C	5: 43,285,933	F989S	probably damaging	Het
Ddx3y	T	C	Y: 1,263,928	N545S	probably null	Het
Eef2k	A	G	7: 120,889,235	S448G	probably benign	Het
Irf2bpl	T	C	12: 86,881,857	I681V	probably benign	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Morc2b	A	G	17: 33,136,278	V840A	probably damaging	Het
Rcl1	A	G	19: 29,118,230	T72A	probably benign	Het
Robo1	T	C	16: 72,983,770	F796S	probably benign	Het
Rsf1	A	AAGGCGACGG	7: 97,579,904		probably null	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Tars	T	C	15: 11,392,904	Y152C	probably damaging	Het
Tmem184a	A	G	5: 139,807,955		probably null	Het
Tmem8	G	A	17: 26,118,886	V415I	probably benign	Het
Tsc2	A	C	17: 24,622,550	I365S	possibly damaging	Het
Usp17la	G	A	7: 104,861,072	V295I	probably damaging	Het
Vim	A	T	2: 13,578,626	H253L	possibly damaging	Het

Other mutations in Dcaf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02431:Dcaf10	APN	4	45342630	missense	probably benign	0.01
IGL02660:Dcaf10	APN	4	45372769	missense	possibly damaging	0.92
R0048:Dcaf10	UTSW	4	45374262	nonsense	probably null
R0550:Dcaf10	UTSW	4	45372753	missense	probably benign
R0611:Dcaf10	UTSW	4	45373011	missense	probably damaging	1.00
R2289:Dcaf10	UTSW	4	45359816	missense	probably damaging	1.00
R2973:Dcaf10	UTSW	4	45373957	missense	probably benign	0.04
R3735:Dcaf10	UTSW	4	45348117	missense	probably benign	0.01
R4655:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4665:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4690:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4724:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4725:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4735:Dcaf10	UTSW	4	45372769	missense	possibly damaging	0.92
R4743:Dcaf10	UTSW	4	45370409	missense	probably damaging	0.98
R5220:Dcaf10	UTSW	4	45373909	missense	possibly damaging	0.94
R5254:Dcaf10	UTSW	4	45370415	missense	possibly damaging	0.94
R5855:Dcaf10	UTSW	4	45342558	missense	probably benign	0.18
R6833:Dcaf10	UTSW	4	45373043	missense	probably damaging	1.00
R7132:Dcaf10	UTSW	4	45342391	missense	probably benign
R7345:Dcaf10	UTSW	4	45342583	missense	probably damaging	0.98
R7366:Dcaf10	UTSW	4	45373919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTCTCGAGCCTCTCAAC -3'
(R):5'- TTACCAGCCTAAGGTCTGAAC -3'

Sequencing Primer
(F):5'- GTCTCGAGCCTCTCAACGAGAAG -3'
(R):5'- GCCTAAGGTCTGAACATGGACATC -3'

Posted On

2015-02-19