Incidental Mutation 'R3610:Cpeb2'
List |< first << previous [record 4 of 20] next >> last >|
ID269199
Institutional Source Beutler Lab
Gene Symbol Cpeb2
Ensembl Gene ENSMUSG00000039782
Gene Namecytoplasmic polyadenylation element binding protein 2
SynonymsA630055H10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43233170-43289724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43285933 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 989 (F989S)
Ref Sequence ENSEMBL: ENSMUSP00000125857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114066] [ENSMUST00000166713] [ENSMUST00000169035]
Predicted Effect unknown
Transcript: ENSMUST00000114065
AA Change: F845S
SMART Domains Protein: ENSMUSP00000109699
Gene: ENSMUSG00000039782
AA Change: F845S

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
RRM 265 337 1.5e-4 SMART
RRM 373 446 1.86e-2 SMART
PDB:2M13|A 447 512 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114066
SMART Domains Protein: ENSMUSP00000109700
Gene: ENSMUSG00000039782

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
RRM 273 345 1.5e-4 SMART
RRM 381 454 1.86e-2 SMART
PDB:2M13|A 455 520 1e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000166713
AA Change: F1019S
SMART Domains Protein: ENSMUSP00000130921
Gene: ENSMUSG00000039782
AA Change: F1019S

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
RRM 758 830 1.5e-4 SMART
RRM 866 939 1.86e-2 SMART
PDB:2M13|A 940 1005 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000169035
AA Change: F989S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125857
Gene: ENSMUSG00000039782
AA Change: F989S

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
RRM 736 808 1.5e-4 SMART
RRM 844 917 1.86e-2 SMART
PDB:2M13|A 918 983 2e-6 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, decreased heart rate, and increased parasympathetic signaling leading to increased pulmonary acetylcholine level, bronchoconstriction, severe apnea, and abnormal breathing patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Cpeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Cpeb2 APN 5 43285831 missense probably damaging 0.98
IGL00771:Cpeb2 APN 5 43237547 missense possibly damaging 0.94
IGL00797:Cpeb2 APN 5 43281447 missense probably damaging 1.00
IGL01604:Cpeb2 APN 5 43278695 critical splice donor site probably null
IGL01632:Cpeb2 APN 5 43237422 missense probably benign 0.25
IGL03137:Cpeb2 APN 5 43261724 splice site probably benign
R0125:Cpeb2 UTSW 5 43238400 intron probably benign
R0200:Cpeb2 UTSW 5 43261776 missense possibly damaging 0.57
R0453:Cpeb2 UTSW 5 43285713 splice site probably benign
R1411:Cpeb2 UTSW 5 43233770 unclassified probably benign
R1542:Cpeb2 UTSW 5 43285875 missense probably damaging 1.00
R1563:Cpeb2 UTSW 5 43285737 missense probably damaging 1.00
R1573:Cpeb2 UTSW 5 43283930 splice site probably benign
R1703:Cpeb2 UTSW 5 43233838 unclassified probably benign
R1899:Cpeb2 UTSW 5 43277587 missense probably damaging 1.00
R1942:Cpeb2 UTSW 5 43235253 intron probably benign
R3429:Cpeb2 UTSW 5 43281230 critical splice donor site probably null
R3848:Cpeb2 UTSW 5 43237445 missense probably damaging 0.97
R4005:Cpeb2 UTSW 5 43238412 intron probably benign
R4306:Cpeb2 UTSW 5 43235235 intron probably benign
R4667:Cpeb2 UTSW 5 43233892 unclassified probably benign
R4754:Cpeb2 UTSW 5 43285857 missense possibly damaging 0.93
R4821:Cpeb2 UTSW 5 43233474 unclassified probably benign
R4906:Cpeb2 UTSW 5 43244662 missense possibly damaging 0.50
R5237:Cpeb2 UTSW 5 43285756 missense probably damaging 0.99
R6693:Cpeb2 UTSW 5 43285912 missense probably damaging 1.00
R7473:Cpeb2 UTSW 5 43277505 missense
Predicted Primers PCR Primer
(F):5'- AGATGTGTGACGAGTGCCAG -3'
(R):5'- TAAGTGCACGCTTCACCCAC -3'

Sequencing Primer
(F):5'- TGACGAGTGCCAGGGTGC -3'
(R):5'- CCACTATATAGCAGCAGACTGTGTTG -3'
Posted On2015-02-19